Epidemiology and molecular genetic characteristics of Lyme borreliosis pathogens circulating in tick’s population in the Almaty oblast of the Republic of Kazakhstan

Cover Page


Cite item

Abstract

Background. Information on the geographical distribution of different species of the Borrelia burgdorferi sensu lato (B. burgdorferi s.l.) complex is of great epidemiological importance, since different genospecies are associated with certain clinical manifestations of Lyme borreliosis. Although Almaty region of the Republic of Kazakhstan is considered to be endemic for tick-borne borreliosis, there is still no accurate data on the level of borrelia infection in ticks in the region, including information on the genotypes of circulating borrelia.

The aim of this work was to study ticks collected from humans in the Almaty region of the Republic of Kazakhstan in 2018.

Materials and methods. Ticks were tested for the presence of B. burgdorferi s.l. DNA, genotyping of the identified borrelia was done by sequencing of the fragment of 16S rRNA gene. The analysis of epidemiological data on the incidence of Lyme borreliosis in the Almaty region in 2013–2018 was performed.

Results. Rhipicephalus turanicus (116/253), Haemaphysalis punctata (74/253), Dermacentor marginatus (28/253), and Ixodes persulcatus (23/253) were the predominant species of ticks taken from humans. The prevalence of B. burgdorferi s.l. infection in I. persulcatus ticks was 39.13% (9/23) It should be noted that the DNA of B. burgdorferi s.l. was also detected in single individuals of D. marginatus, H. punctata, and R. turanicus, although these species are not considered as competent B. burgdorferi s.l. vectors.

Conclusion. As a result of sequencing of the positive homogenates of ticks, two genotypes of B. burgdorferi s.l. were identified: B. afzelii and B. garinii and/or B. bavariensis. Thus, at least two genospecies, B. afzelii and B. garinii and/or B. bavariensis, circulate in the territory of the Almaty region.

Full Text

Введение

Боррелии — грамотрицательные спирохеты, относящиеся к порядку Spirochaetales, семейству Spirосhaetaceae, роду Borrelia, являются облигатными внутриклеточными паразитами [1]. Представители Borrelia spp. сгруппированы в три основные филогенетические группы: группа Лайм-боррелиоза (ЛБ), формирующая надвидовой комплекс B. burgdorferi sensu lato (B. burgdorferi s.l.), группа боррелий клещевых возвратных лихорадок, в которую входят B. miyamotoi, B. theileri и B. lonestari, а также группа боррелий, связанных с рептилиями, включающая B. turcica [2][3][4].

К комплексу B. burgdorferi s.l. на сегодняшний день относят 22 геновида на основе общности генетических характеристик. По крайней мере 10 из них (B. afzelii, B. bavariensis, B. bissettii, B. burgdorferi sensu stricto, B. garinii, B. kurtenbachii, B. lusitaniae, B. spielmanii и B. valaisiana [5][6][7], B. chilensis [8]) являются патогенными для человека, и один геновид — B. mayonii — был недавно выделен из клинических образцов пациента, но его патогенность еще не была доказана экспериментально [9]. Каждый из патогенных геновидов тропен к определенным системам органов, хотя при этом может вызывать поражения любой локализации.

Заражение людей происходит при укусе иксодовых клещей, которые, в свою очередь, заражаются B. burgdorferi на любом этапе своего жизненного цикла, во время укуса естественных хозяев боррелий (мыши, полевки, бурундуки и другие мелкие млекопитающие, олени, а также некоторые виды птиц) [10]. Хотя возбудителей ЛБ периодически детектируют в клещах, относящихся к родам Boophilus, Dermacentor, Haemaphysalis, Hyalomma и Rhipicephalus, возможность выступать в качестве переносчиков заболевания доказана лишь для представителей рода Ixodes [11]. Основными векторами патогенов ЛБ в США и Канаде являются I. scapularis и I. pacificus, в Европе — I. ricinus, в Азии — I. persulcatus [1][11]. В Казахстане основным переносчиком боррелий является I. persulcatus [12][13][14][15]. На территории Казахстана встречаются и другие представители рода Ixodes (I. kazakstani, I. pavlovskyi, I. laguri, I. crenulatus, I. redikorzevi, I. stromi, I. cornutus, I. subterraneus, I. lividus, I. apronophorus, I. eldaricus) [14][16], но их роль в качестве переносчиков ЛБ пока остается невыясненной [16].

Официальная регистрация ЛБ в Казахстане была начата в 2012 г. [12][15]. Эндемичными по данному заболеванию считаются Алматинская и Восточно-Казахстанская области, на территории которых сосредоточены ареалы распространения I. persulcatus. Однако в последнее время единичные случаи данного заболевания стали регистрироваться в Акмолинской, Костанайской и Северо-Казахстанской областях [17]. Инфицированность клещей рода Ixodes B. burgdorferi s.l. в Восточно-Казахстанской области составляет около 40,9% [13], однако в Алматинской области данный показатель не определен. Геновиды надвидового комплекса B. burgdorferi s.l., циркулирующих в популяции клещей, обитающих на территории Алматинской области, не изучены.

Согласно классификации Кёппена–Гейгера, территория Алматинской области характеризуется влажным континентальным климатом, включающим 5 климатических зон: жаркий-летний влажный континентальный климат (Dfa), холодный полузасушливый климат (BSk), теплый-летний влажный континентальный климат (Dfb), средиземноморский жаркий-летний влажный континентальный климат (Dsa), холодный пустынный климат (BWk) [18]. Южный и восточный районы области расположены у подножия хребта северного Тянь-Шаня — Заилийского Алатау и Джунгарского Алатау. Предгорные и горные районы Алматинской области состоят из лиственных и смешанных лесов, типичных мест обитания I. persulcatus [19].

Характерные для ЛБ полиморфность клинической картины, сходность симптоматики с рядом других заболеваний, одновременное поражение нескольких органов и частая латентная персистенция возбудителя в организме могут приводить к ошибкам в диагностике заболевания, поздней постановке диагноза, несвоевременной медицинской помощи и, как следствие, к серьезным социально-экономическим потерям, связанным с временной нетрудоспособностью и инвалидизацией пациентов [13][20][21]. Известно, что геновиды B. burgdorferi s.l связаны с различной патогенностью и клиническими проявлениями у пациентов. В связи с этим определение генотипов, циркулирующих в том или ином регионе, является важным для диагностики заболевания и может содействовать лучшему ведению пациентов с ЛБ [22].

В эпидемиологических исследованиях для детекции и генотипирования наиболее часто применяются видоспецифичный ПЦР-анализ, полиморфизм длины рестрикционных фрагментов, анализ последовательности конкретных локусов генов [11]. В качестве мишеней при диагностике и генотипировании B. burgdorferi s.l. методами на основе ПЦР чаще всего используют гены рибосомной РНК (рРНК), такие как flaB, recA, p66 и плазмидный ген ospA [11]. Наличие в гене 16S рРНК как высококонсервативных, так и гипервариабельных участков позволяет, помимо выявления ДНК B burgdorferi s.l., осуществлять типирование боррелий для выявления геновидов, а также проводить филогенетический анализ различных генотипов этих бактерий [23][24].

Практика изучения зараженности клещей в эндемичных районах основывается на методах активного и пассивного мониторинга, а также эпидемиологического надзора за случаями ЛБ. При этом пассивный мониторинг дает возможность проанализировать не только уровень распространенности клещей в отдельных районах и степень зараженности их патогенами, но и риск заражения людей [25], а также успешно предсказать появление случаев
заболевания людей и своевременно выявить новые зоны распространения ЛБ [26].

Поскольку в Алматинской области ежегодно увеличивается количество атак клещей и случаев лихорадки неясной этиологии [27], выявление уровня зараженности клещей B. burgdorferi s.l. и их генотипов крайне необходимо для разработки эффективных мер профилактики заболеваемости ЛБ. Понимание возможной дифференциальной патогенности между боррелиями разных генотипов важно для изучения этиологии заболевания и улучшения лабораторной диагностики.

Целью настоящего исследования был пассивный мониторинг распространенности и степени зараженности клещей разных видов B. burgdorferi s.l. и их генотипирование по гену 16S рРНК для определения генотипов, циркулирующих в популяции клещей, а также анализ эпидемиологических данных по заболеваемости ЛБ в Алматинской области за 2013–2018 гг.

Материалы и методы

Для анализа эпидемиологических данных по заболеваемости ЛБ в Алматинской области использовали материалы Научно-практического центра санитарно-эпидемиологической экспертизы и мониторинга (НПЦСЭЭиМ) Комитета охраны общественного здоровья Министерства здравоохранения Республики Казахстан за 2013–2018 гг. [27].

Также в исследовании использовали 253 клеща, снятых с людей, проживающих в Алматинской области, в период с марта по июль 2018 г. Клещи были предоставлены НПЦСЭЭиМ. Видовую идентификацию клещей проводили морфологически с использованием лупы, бинокулярного микроскопа и таксономических ключей идентификатора «Кровососущие клещи Казахстана» [28]. После этого клещей замораживали в индивидуальных криопробирках при –20°С.

Клещей гомогенизировали индивидуально с использованием герметичного гомогенизатора «Homogenizer Mixer Mill MM 400» («Retsch»). Для этого единичных клещей помещали в пробирки с тремя размольными боросиликатными шарами (5 мм в диаметре) и 600 мкл фосфатно-солевого буфера и проводили гомогенизацию в течение 3 мин при 30 Гц. Гомогенаты центрифугировали в течение 5 мин при 5000g и 4°С. Далее отбирали супернатанты, из которых выделяли нуклеиновые кислоты с использованием набора «АмплиСенс® РИБО-преп» («ИнтерЛабСервис») согласно инструкции производителя.

ДНК B. burgdorferi s.l. выявляли с использованием набора «АмплиСенс® TBEV, B. burgdorferi s.l., A. phagocytophilum, E. chaffeensis/E.muris-FL» («ИнтерЛабСервис») по методике производителя. Положительными считали образцы, значение Ct которых было меньше 38.

Для секвенирования ДНК B. burgdorferi s.l. сначала проводили амплификацию участка гена 16S рРНК боррелий с использованием полимеразы High-Fidelity («Thermo Fisher») в амплификаторе «Mastercycler X50h» («Eppendorf») с использованием праймеров 16S1A (5’CTAACGCTGGCAGTGCGTCTTAAGC)/16S1B (5’AGCGTCAGTCTTGACCCAGAAGTTC) [29]. Далее проводили электрофорез полученных нуклеиновых кислот в системе для электрофореза «BioRad» в 1,5% агарозном геле на 1× трис-ацетатном буфере, содержащем 0,5 пг/мл бромистого этидия («SigmaAldrich»). Элюцию ДНК-фрагментов из агарозного геля проводили с использованием набора «QIAquick Gel Extraction Kit» («Qiagen») по методике производителя. Очищенные амплификаты секвенировали в обоих направлениях, используя праймеры для ПЦР, набор для секвенирования «BigDye® Terminator v3.1» («Applied Biosystems») и генетический анализатор «ABI 3500XL» («Applied Biosystems»). Полученные участки гена 16S рРНК сравнивали с нуклеотидными последовательностями различных геновидов боррелий, взятыми из базы данных NCBI1, и выравнивали с использованием алгоритма MUSCLE. Филогенетическое древо было создано методом максимального правдоподобия с использованием программного обеспечения «MEGA X»2. Значения надежности в процентах на каждом внутреннем узле были определены в соответствии с анализом начальной загрузки с 1000 повторов.

Статистическую обработку результатов проводили с применением программы R. Для расчета 95% доверительных интервалов (95% ДИ) был использован метод Клоппера–Пирсона. Критерий Пирсона χиспользовался для определения статистически значимой разницы между ожидаемыми частотами. Различия считали статистически значимыми при р < 0,05.

Результаты

Анализ эпидемиологических данных по заболеваемости ЛБ за 2013–2018 гг.

На данный момент в районах Казахстана, эндемичных по клещевым инфекциям, существует значительный пробел в мониторинге лиц, укушенных клещами. Клещи, принесенные укушенными пациентами, не проверяются на наличие возбудителя боррелиоза, не проводится комплексное серологическое обследование пациентов в динамике, что затрудняет своевременную диагностику заболеваний.

По данным НПЦСЭЭиМ, количество подтвержденных случаев ЛБ в Казахстане за 2013– 2018 гг. варьирует от 7 до 21 случая в год, таким образом средний уровень заболеваемости составляет 0,04–0,12 на 100 тыс. человек в год (табл. 1) [27].

 

Таблица 1. Мониторинг заболеваемости ЛБ в Республике Казахстан в 2013–2018 гг.

Table 1. Monitoring of the LB incidence in the Republic of Kazakhstan in 2013–2018

 

Что касается Алматинской области, то в 2017 г. было зарегистрировано 4 подтвержденных случая ЛБ (0,11 на 100 тыс. человек), а в 2018 г. — 7 случаев (0,19 на 100 тыс. человек). К сожалению, клещи, укусившие данных пациентов, не были включены в наше исследование.

Видовой состав клещей, нападавших на людей в Алматинской области

Клещи, снятые с пострадавших от укуса людей в Алматинской области в марте–июле 2018 г., были идентифицированы до вида. Основываясь на морфологической идентификации, все 253 клеща были отнесены к имаго. Из 253 клещей 23 (9,1%) принадлежали к основному переносчику ЛБ — I. persulcatus (95% ДИ 5,9–13,3%; рис. 1). Наиболее часто на людей в Алматинской области нападали клещи R. turanicus (116/253; 45,9%; 95% ДИ
39,5–52,2%), Ha. punctata (74/253; 29,3%; 95% ДИ 23,7–35,3%) и D. marginatus (28/253; 11,1%; 95% ДИ 7,5–15,6%). Наименьшее количество напавших на людей клещей были идентифицированы как Hy. asiaticum (7/253; 2,7%; 95% ДИ 1,1–5,6%) и D. pictus (5/253, 1,9%; 95% ДИ 0,6–4,5%; рис. 1).

 

Рис. 1. Видовой состав клещей, снятых с людей в Алматинской области в марте–июле 2018 г.

Fig. 1. Species composition of ticks collected from people in Almaty region in the period from March to July 2018.

 

Периоды активности у разных родов клещей отличаются. Период наибольшей активности основного переносчика возбудителей ЛБ I. persulcatus в Алматинской области был отмечен с апреля по июнь. Преобладающие по количеству укусов виды клещей (R. turanicus, Ha. punctata и D. marginatus) проявляли наибольшую активность в период с мая по июнь, с апреля по июнь и с апреля по май соответственно (рис. 2).

 

Рис. 2. Данные по клещам, снятым с людей в 2018 г. в Алматинской области.а — общее число нападений клещей разных видов на людей по месяцам; б — процентное соотношение снятых с людей клещей по видам помесячно (общее число нападений клещей одного вида принято за 100%).

Fig. 2. Data on ticks collected from humans in 2018 in the Almaty region.
а — the total number of attacks by ticks of different species on people by months (the abscissa shows the months, the ordinate shows the number of tick bites); b — percentage of ticks collected from humans by species per month (the total number of attacks by ticks of one species is taken as 100%) (the abscissa shows the months; the ordinate shows the percentage of ticks collected from humans by species in each month).
 

ПЦР-диагностика ДНК-препаратов клещей

В ходе анализа ДНК-препаратов клещей, снятых с людей в Алматинской области в 2018 г., методом ПЦР в режиме реального времени выявлено, что I. persulcatus являются наиболее инфицированными B. burgdorferi s.l. Однако ДНК B. burgdorferi s.l. была детектирована также в клещах D. marginatus, Ha. punctata и R. turanicus (табл. 2). В любом случае уровень инфицированности клещей I. persulcatus боррелиями B. burgdorferi s.l. был достоверно выше, чем тот же показатель для D. marginatus (χ2 = 7,9980; p = 0,001), Ha. punctata (χ= 23,154; p < 0,0001) и R. turanicus (χ= 21,986; p < 0,0001). Уровни инфицированности B. burgdorferi s.l. клещей, не относящихся к роду Ixodes, не отличались достоверно друг от друга (χ= 0,6832; p = 0,5).

 

Таблица 2. Результаты ПЦР-анализа по детекции ДНК B. burgdorferi s.l. в клещах

Table 2. Results of PCR analysis for the detection of B. burgdorferi s.l. DNA in ticks

 

Следует также заметить, что относительное содержание B. burgdorferi s.l. в клещах D. marginatus, Ha. punctata и R. turanicus оказалось низким по сравнению со средним их содержанием в I. persulcatus, исходя из сравнительно высоких значений Ct (табл. 2).

Секвенирование и филогенетический анализ

Определение видовой принадлежности 16 qPCR-положительных образцов, выделенных из иксодовых клещей, осуществлялось посредством амплификации части гена 16S рРНК размером 724 п.н. родоспецифичными праймерами с последующим секвенированием очищенных амплификатов. В качестве положительного контроля в ПЦР использовали геномную ДНК B. garinii. В 3 из 16 образцов не удалось получить амплификат, видимо, из-за низкого содержания в них ДНК B. burgdorferi s.l. На рис. 3 представлены результаты электрофоретического анализа продуктов амплификации участка гена 16S рРНК для 5 образцов, выделенных из I. persulcatus, для которых удалось получить считывание достаточного для анализа качества. Остальные 8 из 13 проанализированных методом секвенирования ДНК образцов давали миксы по нескольким позициям, что указывает на наличие в них ДНК от более чем одного геновида боррелий.

 

Рис. 3. Электрофоретический анализ продуктов амплификации участка гена 16S рРНК Borrelia spp. с использованием праймеров 16S1A/16S1B.1 kb — ДНК-маркер GeneRuler 1 kb, 100 bp — ДНК-маркер GeneRuler 100 bp plus; PC — B. garinii (положительный контроль); NC — негативный контроль. A003A1, A012A1, A041A1, A186A1, A196A1 — образцы ДНК, выделенные из одиночных клещей.

Fig. 3. Electrophoretic analysis of amplification products of the 16S rRNA gene region of Borrelia spp. using primers 16S1A/16S1B.
1 kb — GeneRuler 1 kb DNA ladder; 100 bp — GeneRuler 100 bp plus DNA ladder; PC — B. garinii (positive control); NC — negative control. A003A1, A012A1, A041A1, A186A1, A196A1 — DNA samples, isolated from individual ticks.
 

Согласно результатам проведенного филогенетического анализа, 4 образца (A003A1, A012A1, A041A1 и A196A1) были идентичны по последовательности амплификата линии VS461 (GenBank NR_104748.1) B. afzelii (рис. 4). Один образец (A186A1) содержал ДНК, наиболее близкую по последовательности амплифицированного участка гена 16S рРНК к линии PBi (GenBank NR_074854.1) B. bavariensis (2 нуклеотидные замены) и линии 20047 (GeneBank NR_043413.1) B. garinii (3 нуклеотидные замены) (рис. 4).

 

Рис. 4. Филогенетическое дерево Borrelia spp., обнаруженных в клещах I. persulcatus, на основе фрагмента гена 16S рРНК. Треугольниками отмечены образцы из настоящего исследования. Единица шкалы соответствует 0,005 нуклеотидной замене в пересчете на одну нуклеотидную позицию.

Fig. 4. Phylogenetic tree of Borrelia spp. detected in I. persulcatus ticks based on the 16S rRNA gene fragment. The triangles indicate the samples from the present study. The scale unit corresponds to 0.005 nucleotide substitution per one nucleotide position.
 

Обсуждение

В настоящей работе представлены анализ данных по подтвержденным случаям клещевого боррелиоза в Казахстане и данные видовой идентификации по видам клещей, нападавших на людей в Алматинской области Республики Казахстан с марта по июль 2018 г., уровня их инфицированности возбудителями ЛБ, а также генотипирования выявленных боррелий по участку гена 16S рРНК.

Доминирующими видами клещей, нападающими на людей, были R. turanicus, Ha. punctata, D. marginatus и I. persulcatus. Наиболее высокий уровень зараженности B. burgdorferi s.l. показали клещи I. persulcatus. Несмотря на то что этот показатель является сравнительно высоким, за 2018 г. в Алматинской области, в которой ареал распространения I. persulcatus перекрывается с наиболее густозаселенными районами, зарегистрировано лишь 7 официально подтвержденных случаев клещевого боррелиоза [27]. Возможно, это связано с отсутствием эффективной и своевременной системы диагностики данного заболевания в областных и городских клиниках в силу некоторых факторов: например, низкой информированности врачей о клинических проявлениях ЛБ, который характеризуется выраженным клиническим полиморфизмом течения заболевания; недостаточности/отсутствия в клиниках специфических методов лабораторной диагностики, а также вариабельности результатов таких лабораторных методов на разных стадиях инфекции [20][21]. Немаловажным является установление факта наличия укуса клеща, т.к. укус клещей зачастую бывает безболезненным и только около 50% пациентов с ЛБ указывают на факт присасывания клеща, что также усложняет процесс диагностики [13][15].

Согласно результатам анализа ДНК-препаратов клещей, снятых с людей в Алматинской области, выявлено, что I. persulcatus являются наиболее инфицированными B. burgdorferi s.l. Однако следует отметить, что ДНК B. burgdorferi s.l. была детектирована также в клещах D. marginatus, Ha. punctata и R. turanicus, что было продемонстрировано ранее и другими исследовательскими группами. Так, например, F.K. Adham и соавт. показали, что в Египте агенты ЛБ были обнаружены в нескольких видах клещей: Rhipicephalus, Hyalomma и Ornithodoros savignyi, частично с высокой распространенностью — до 66% [30]. Дополнительно Borrelia spp. были обнаружены у клещей-олигофагов, таких как I. frontalis, I. acuminatus и Argas reflexus, а также у полифагов Haemaphysalis [11][31]. Однако способность заражать людей B. burgdorferi s.l. для данных видов клещей не была доказана [31]. Таким образом, роль этих видов в энзоотических циклах агентов ЛБ остается неясной.

По результатам секвенирования в реальном времени ПЦР-положительных по B. burgdorferi s.l. образцов установлено, что в Алматинской области циркулируют по меньшей мере два геновида B. burgdorferi s.l. (B. afzelii и B. garinii и или B. bavariensis). Однако полученные результаты требуют дополнительных исследований и подтверждений. Наше исследование было частично ограничено некоторыми факторами: отсутствием клинических данных от укушенных исследованными клещами людей, недостаточным количеством исследуемых образцов и объёмом их выборки, отсутствием точных данных ГИС-координат по точкам, где были зарегистрированы укусы клещей, лимитированностью в наличии коммерческих тест-систем для детекции B. burgdorferi s.l., а также материалов для таких современных методов генотипирования, как MLST/MLSA.

Данным исследованием мы хотим подчеркнуть факт зараженности и определенной распространенности патогенов ЛБ в популяции клещей Алматинской области Республики Казахстан. Более того, большая гетерогенность самих патогенов и их переносчиков все еще оставляет многие вопросы без ответа. Следовательно, для более точной картины распространенности и уровня зараженности клещей разных видов, в частности I. persulcatus, патогенами клещевого боррелиоза в дальнейшем необходимо продолжить исследования, охватывающие следующие области:

  • комплексные эпидемиологические исследования, в том числе в регионах за пределами основных районов распространения I. persulcatus;
  • обнаружение коинфекций с другими клещевыми патогенами и выявление биотических и абиотических факторов, которые влияют на распространение Borrelia spp.;
  • ассоциации хозяина и вектора: cпирохеты комплекса ЛБ могут быть обнаружены в неожиданно широком диапазоне возможных векторов, что указывает на необходимость изучения потенциала различных видов членистоногих в отношении передачи агентов ЛБ людям или резервуарам позвоночных;
  • филогения и таксономия спирохет Borrelia spp.: для характеристики новых генотипов рекомендуется применение самых современных методов, таких как MLSA/MLST.

Благодарность

Авторы выражают признательность Л.С. Карань (ЦНИИ Эпидемиологии Роспотребнадзора) за предоставление в качестве положительного контроля геномной ДНК B. garinii.

×

About the authors

A. O. Bissenbay

Almaty Branch of Republican State Enterprise «National Center for Biotechnology» — Central Reference Laboratory

Author for correspondence.
Email: akerke.bissenbay@gmail.com
ORCID iD: 0000-0002-7109-2534

Akerke O. Bissenbay — researcher, Department of biosafety and biosecurity

050054, Almaty

Kazakhstan

A. V. Zhigailov

Almaty Branch of Republican State Enterprise «National Center for Biotechnology» — Central Reference Laboratory

Email: fake@neicon.ru
ORCID iD: 0000-0002-9646-033X

Andrey V. Zhigailov — PhD (Biol.), leading researcher, Laboratory of molecular biology

050054, Almaty

Kazakhstan

Yu. V. Perfilyeva

Almaty Branch of Republican State Enterprise «National Center for Biotechnology» — Central Reference Laboratory

Email: fake@neicon.ru
ORCID iD: 0000-0001-6803-0773

Yuliya V. Perfilyeva — PhD (Biol.), leading researcher, Laboratory for expertise and diagnostics

050054, Almaty

Kazakhstan

D. A. Naizabayeva

Almaty Branch of Republican State Enterprise «National Center for Biotechnology» — Central Reference Laboratory

Email: fake@neicon.ru
ORCID iD: 0000-0002-0606-4289

Dinara A. Naizabayeva — junior researcher, Laboratory for expertise and diagnostics

050054, Almaty

Kazakhstan

A. S. Neupokoyeva

Almaty Branch of Republican State Enterprise «National Center for Biotechnology» — Central Reference Laboratory

Email: fake@neicon.ru
ORCID iD: 0000-0001-7257-8037

Alena S. Neupokoyeva — senior researcher, Laboratory for expertise and diagnostics

050054, Almaty

Kazakhstan

Zh. A. Berdygulova

Almaty Branch of Republican State Enterprise «National Center for Biotechnology» — Central Reference Laboratory

Email: fake@neicon.ru
ORCID iD: 0000-0003-0379-2472

Zhanna A. Berdygulova — PhD, leading researcher, Laboratory of molecular biology

050054, Almaty

Kazakhstan

Ye. O. Ostapchuk

Almaty Branch of Republican State Enterprise «National Center for Biotechnology» — Central Reference Laboratory

Email: fake@neicon.ru
ORCID iD: 0000-0002-3771-423X

Yekaterina O. Ostapchuk — PhD, leading researcher, Laboratory of molecular biology

050054, Almaty

Kazakhstan

E. R. Maltseva

Almaty Branch of Republican State Enterprise «National Center for Biotechnology» — Central Reference Laboratory

Email: fake@neicon.ru
ORCID iD: 0000-0001-9198-695X

Elina R. Maltseva — PhD, Head, Biosafety and biosecurity department

050054, Almaty

Kazakhstan

S. A. Kuatbekova

Almaty Branch of Republican State Enterprise «National Center for Biotechnology» — Central Reference Laboratory

Email: fake@neicon.ru
ORCID iD: 0000-0001-5569-1847

Saltanat A. Kuatbekova — junior researcher, Laboratory for expertise and diagnostics

050054, Almaty

Kazakhstan

A. S. Nizkorodova

Almaty Branch of Republican State Enterprise «National Center for Biotechnology» — Central Reference Laboratory

Email: fake@neicon.ru
ORCID iD: 0000-0002-1597-7207

Anna S. Nizkorodova — PhD (Biol.), leading researcher, Laboratory of molecular biology

050054, Almaty

Kazakhstan

A. M. Dmitrovskiy

Almaty Branch of Republican State Enterprise «National Center for Biotechnology» — Central Reference Laboratory

Email: fake@neicon.ru
ORCID iD: 0000-0003-4714-3079

Andrey M. Dmitrovskiy — D. Sci. (Med.), Prof., Head, Laboratory for expertise and diagnostics

050054, Almaty

Kazakhstan

Yu. A. Skiba

Almaty Branch of Republican State Enterprise «National Center for Biotechnology» — Central Reference Laboratory

Email: fake@neicon.ru
ORCID iD: 0000-0003-4895-1473

Yuriy A. Skiba — PhD (Biol.), Deputy director

050054, Almaty

Kazakhstan

S. M. Mamadaliyev

Almaty Branch of Republican State Enterprise «National Center for Biotechnology» — Central Reference Laboratory

Email: fake@neicon.ru
ORCID iD: 0000-0002-7767-0251

Seydigapbar M. Mamadaliyev — D. Sci. (Vet.), Prof., Director

050054, Almaty

Kazakhstan

References

  1. Halperin J.J. Lyme Disease: an Evidence-Based Approach. Wallingford; 2018. https://doi.org/10.1079/9781786392077.0000
  2. Margos G., Vollmer S.A., Ogden N.H., Fish D. Population genetics, taxonomy, phylogeny and evolution of Borrelia burgdorferi sensu lato. Infect. Genet. Evol. 2011; 11(7): 1545–63. https://doi.org/10.1016/j.meegid.2011.07.022
  3. Adam T., Gossman G.S., Rasiah C., Göbel U.B. Phenotypic and genotypic analysis of Borrelia burgdorferi isolates from various sources. Infect. Immunol. 1991; 59(8): 2579–85. https://doi.org/10.1128/IAI.59.8.2579-2585.1991
  4. Baranton G., Marti R.N., Postic D. Borrelia burgdorferi, taxonomy, pathogenicity and spread. Ann. Med. Interne (Paris). 1998; 149(7): 455–8. (in French)
  5. Stanek G., Reiter M. The expanding Lyme Borrelia complex clinical significance of genomic species? Clin. Microbiol. Infect. 2011; 17(4): 487–93. https://doi.org/10.1111/j.1469-0691.2011.03492.x
  6. Rudenko N., Golovchenko M., Grubhoffer L., Oliver J.H. Updates on Borrelia burgdorferi sensu lato complex with respect to public health. Ticks Tick Borne Dis. 2011; 2(3): 123–8. https://doi.org/10.1016/j.ttbdis.2011.04.002
  7. Margos G., Lane R.S., Fedorova N., Koloczek J., Piesman J., Hojgaard A., et al. Borrelia bissettiae sp. nov. and Borrelia californiensis sp. nov. prevail in diverse enzootic transmission cycles. Int. J. Syst. Evol. Microbiol. 2016; 66(3): 1447–52. https://doi.org/10.1099/ijsem.0.000897
  8. Ivanova L.B., Tomova A., González-Acuña D., Murúa R., Moreno C.X., Hernández C., et al. Borrelia chilensis, a new member of the Borrelia burgdorferi sensu lato complex that extends the range of this genospecies in the Southern Hemisphere. Environ. Microbiol. 2014; 16(4): 1069–80. https://doi.org/10.1111/1462-2920.12310
  9. Pritt B.S., Respicio-Kingry L.B., Sloan L.M., Schriefer M.E., Replogle A.J., Bjork J., et al. Borrelia mayonii sp. nov., a member of the Borrelia burgdorferi sensu lato complex, detected in patients and ticks in the upper midwestern United States. Int. J. Syst. Evol. Microbiol. 2016; 66(11): 4878–80. https://doi.org/10.1099/ijsem.0.001445
  10. Shapiro E.D. Borrelia burgdorferi (Lyme disease). Pediatr. Rev. 2014; 35(12): 500–9. https://doi.org/10.1542/pir.35-12-500
  11. Franke J., Hildebrandt A., Dorn W. Exploring gaps in our knowledge on Lyme borreliosis spirochaetes — updates on complex heterogeneity, ecology, and pathogenicity. Ticks Tick Borne Dis. 2013; 4(1-2): 11–25. https://doi.org/10.1016/j.ttbdis.2012.06.007
  12. Егембердиева Р.А., Ермуханова Н.Т., Дмитровский А.М., Шапиева Ж.Ж., Кыраубаев К.К., Лавренюк В.И. Эпидемиологическая характеристика некоторых клещевых трансмиссивных инфекций в Казахстане. Национальные приоритеты России. 2013; (2): 92–4.
  13. Егембердиева Р.А., Токсанбаева К.Н., Дуйсенова А.К., Ермуханова Н.Т. Клинические проявления хронических форм клещевого боррелиоза в Восточно-Казахстанской области. Вестник Казахского национального медицинского университета. 2013; (2): 89–92.
  14. Филиппова Н.А. Иксодовые клещи подсемейства Ixodidae. В кн.: Филиппова Н.А. Фауна СССР. Паукообразные. Том IV, выпуск 4. Ленинград: Наука; 1977.
  15. Егембердиева Р.А. Клинико-эпидемиологические проявления некоторых природно-очаговых трансмиссивных инфекций в Казахстане: Дисс. д-ра мед. наук. Алматы; 2011.
  16. Kovalev S.Y., Fedorova S.Zh., Mukhacheva T.A. Molecular features of Ixodes kazakstani: first results. Ticks Tick Borne Dis. 2018; 9(3): 759–61. https://doi.org/10.1016/j.ttbdis.2018.02.019
  17. Курмангалиева К.Б., Атыгаева С.К., Жамбурчинова А.Н., Ширшикбаева Г.Е. Случай болезни Лайма в неэндемичном регионе. Журнал инфектологии. 2014; 6(1): 93–4.
  18. Rubel F., Brugger K., Walter M., Vogelgesang J.R., Didyk Y.M., Fu S., et al. Geographical distribution, climate adaptation and vector competence of the Eurasian hard tick Haemaphysalis concinna. Ticks Tick Borne Dis. 2018; 9(5): 1080–9. https://doi.org/10.1016/j.ttbdis.2018.04.002
  19. Perfilyeva Y.V., Shapiyeva Zh., Ostapchuk E.O., Berdygulova Zh., Bissenbay A.O., Kulemin M.V., et al. Tick-borne pathogens and their vectors in Kazakhstan — а review. Ticks Tick Borne Dis. 2020; 11(5): 101498. https://doi.org/10.1016/j.ttbdis.2020.101498
  20. Strle F., Stanek G. Clinical manifestations and diagnosis of Lyme borreliosis. Curr. Probl. Dermatology. 2009; 37: 51–110. https://doi.org/10.1159/000213070
  21. Карпов И.А., Соловей Н.В., Анисько Л.А., Щерба В.В., Данилов Д.Е. Лайм-боррелиоз: вопросы диагностики и рациональной этиотропной терапии. Клиническая инфектология и паразитология. 2015; (3): 64–80.
  22. Crowder C.D., Matthews H.E., Schutzer S., Rounds M.A., Luft B.J., Nolte O., et al. Genotypic variation and mixtures of Lyme Borrelia in Ixodes ticks from North America and Europe. PLoS One. 2010; 5(5): e10650. https://doi.org/10.1371/journal.pone.0010650
  23. Lee S.H., Vigliotti V.S., Vigliotti J.S., Jones W., Pappu S. Increased sensitivity and specificity of Borrelia burgdorferi 16S ribosomal DNA detection. Am. J. Clin. Pathol. 2010; 133(4): 569–76. https://doi.org/10.1309/AJCPI72YAXRHYHEE
  24. Greisen K., Loeffelholz M., Purohit A., Leong D. PCR primers and probes for the 16S rRNA gene of most species of pathogenic bacteria, including bacteria found in cerebrospinal fluid. J. Clin. Microbiol. 1994; 32(2): 335–51. https://doi.org/10.1128/JCM.32.2.335-351.1994
  25. Ogden N.H., Bouchard C., Kurtenbach K., Margos G., Lindsay L.R., Trudel L., et al. Active and passive surveillance and phylogenetic analysis of Borrelia burgdorferi elucidate the process of Lyme disease risk emergence in Canada. Environ. Health Perspect. 2010; 118(7): 909–14. https://doi.org/10.1289/ehp.0901766
  26. Ripoche M., Gasmi S., Adam-Poupart A., Koffi J.K., Lindsay L.R., Ludwig A., et al. Passive tick surveillance provides an accurate early signal of emerging Lyme disease risk and human cases in Southern Canada. J. Med. Entomol. 2018; 55(4): 1016–26. https://doi.org/10.1093/jme/tjy030
  27. Бекшин Ж.М., Есмагамбетова А.С., Ахметов В.Н. Санитарно-эпидемиологическая ситуация в Республике Казахстан за 2018 год. Алматы; 2019: 111–8.
  28. Галузо И.Г. Кровососущие клещи Казахстана. Том 1. Алма-Ата; 1946.
  29. Richter D., Allgöwer R., Matuschka F.R. Co-feeding transmission and its contribution to the perpetuation of the Lyme disease spirochete Borrelia afzelii. Emerg. Infect. Dis. 2002; 8(12): 1421–5. https://doi.org/10.3201/eid0812.010519
  30. Adham F.K., El-Samie-Abd E.M., Gabre R.M., El Hussein H. Detection of tick blood parasites in Egypt using PCR assay II Borrelia burgdorferi sensu lato. J. Egypt. Soc. Parasitol. 2010. 40: 553–564.
  31. Gern L., Humair P.F. Ecology of Borrelia burgdorferi sensu lato in Europe. In: Gray J., Kahl O., Lane R.S., Stanek G., eds. Lyme Borreliosis Biology, Epidemiology and Control. New York: CABI Publishing; 2002: 149–74.

Supplementary files

Supplementary Files
Action
1. Table 1. Monitoring of the LB incidence in the Republic of Kazakhstan in 2013–2018

Download (22KB)
2. Fig. 1. Species composition of ticks collected from people in Almaty region in the period from March to July 2018.

Download (17KB)
3. Fig. 2. Data on ticks collected from humans in 2018 in the Almaty region.а — the total number of attacks by ticks of different species on people by months (the abscissa shows the months, the ordinate shows the number of tick bites); b — percentage of ticks collected from humans by species per month (the total number of attacks by ticks of one species is taken as 100%) (the abscissa shows the months; the ordinate shows the percentage of ticks collected from humans by species in each month).

Download (47KB)
4. Table 2. Results of PCR analysis for the detection of B. burgdorferi s.l. DNA in ticks

Download (32KB)
5. Fig. 3. Electrophoretic analysis of amplification products of the 16S rRNA gene region of Borrelia spp. using primers 16S1A/16S1B. 1 kb — GeneRuler 1 kb DNA ladder; 100 bp — GeneRuler 100 bp plus DNA ladder; PC — B. garinii (positive control); NC — negative control. A003A1, A012A1, A041A1, A186A1, A196A1 — DNA samples, isolated from individual ticks.

Download (18KB)
6. Fig. 4. Phylogenetic tree of Borrelia spp. detected in I. persulcatus ticks based on the 16S rRNA gene fragment. The triangles indicate the samples from the present study. The scale unit corresponds to 0.005 nucleotide substitution per one nucleotide position.

Download (48KB)

Copyright (c) 2021 Bissenbay A.O., Zhigailov A.V., Perfilyeva Y.V., Naizabayeva D.A., Neupokoyeva A.S., Berdygulova Z.A., Ostapchuk Y.O., Maltseva E.R., Kuatbekova S.A., Nizkorodova A.S., Dmitrovskiy A.M., Skiba Y.A., Mamadaliyev S.M.

Creative Commons License
This work is licensed under a Creative Commons Attribution 4.0 International License.

СМИ зарегистрировано Федеральной службой по надзору в сфере связи, информационных технологий и массовых коммуникаций (Роскомнадзор).
Регистрационный номер и дата принятия решения о регистрации СМИ: ПИ № ФС77-75442 от 01.04.2019 г.


This website uses cookies

You consent to our cookies if you continue to use our website.

About Cookies