Development of a technique for molecular typing of Bacillus anthracis strains using new VNTR and INDEL markers

Full Text

Introduction

Bacillus anthracis is a spore-forming Gram-positive bacillus, the pathogen of anthrax, a particularly dangerous infection with a global distribution area. In early studies, attempts to determine the genetic variability of B. anthracis were unsuccessful, indicating the high genetic monomorphism of this species [1]. The first genetic marker suitable for differentiation of B. anthracis strains was tandem repeats in the chromosomal locus vrrA, which are sequentially repeated identical DNA fragments (variable number tandem repeats, VNTR) [2]. Allelic variants of vrrA with the number of repeats from 2 to 6 allowed all strains to be divided into 5 groups [2, 3]. The marker was included in the first typing scheme by MLVA8 (Multiple loci VNTR analysis, MLVA) consisting of 6 chromosomal and 2 plasmid VNTR loci. VNTR loci in general differ from other variable regions in the fact they have a high frequency of variability and a larger number of variants, as well as the manifestation of the homoplasy effect, i.e. independent or parallel mutations in different genetic lineages [4]. Therefore, genotyping based on the analysis of VNTR loci makes it difficult to study intraspecific evolution, but this method is convenient for epidemiologic investigation of anthrax outbreaks. Active searches for B. anthracis loci with tandem repeats led to the discovery of 32 VNTR markers in 6 MLVA genotyping schemes [5–10].

In order to study genetic diversity, a genotyping method based on the analysis of canonical SNPs (canSNP typing) with the identification of 12 major genetic lineages was developed and tested on a large selection of strains [8]. The canonical lineages most accurately reflect the evolutionary groups of B. anthracis; therefore, they are best suited to describe the distribution of anthrax strains in the world. Subsequently, large-scale phylogenetic studies were performed with detailed descriptions, creation of a nomenclature of names and relationships of genetic clusters. Subclusters of canonical lineages were assigned numbers or trivial names [11, 12]. In particular, the canonical lineage A.Br.008/009 includes the Tsiankovskii and STI subclusters, which are widely represented in the Commonwealth of Independent States.

In 2019, an anthrax outbreak occurred in the Republic of Dagestan with isolates that clustered into a separate phylogenetic group A.Br.125 belonging to the STI subcluster.

The canonical lineage B.Br.001/002 contains the Siberia and Europe clusters, making up B.Br.014, as well as the Asia and B.Br.018 clusters.

Taking into account the established and newly identified designations of genetic lineages and groups, we used the following order in the subsequent description. The canonical lineage is indicated first, followed by a new subgroup or cluster within it with an established designation, if identified. For example, most strains of the main lineage A, isolated in Russia, are designated as A.Br.008/009 (Tsiankovskii) or A.Br.008/009 (STI).

Molecular markers also include INDELs (insertion/deletion), which are non-repeat variable regions that exist predominantly as two genetic variants: with deletion or with insertion.

For Francisella tularensis, an INDEL typing scheme was developed, including 38 INDEL loci. The study showed that the use of such markers increases the accuracy of typing [13]. Genotyping methods based on INDEL-locus analysis have also been developed for Helicobacter pylori, Burkholderia pseudomallei, Vibrio cholerae, Yersinia pseudotuberculosis and proved to be of high resolution and reliable in determining the phylogenetic position of strains [14-17]. Currently, the INDEL genotyping system for B. anthracis has not been developed.

The objectives of the study were to find and characterize VNTR and INDEL loci of B. anthracis and to develop on their basis a genotyping technique by PCR with electrophoretic detection of the results.

Materials and methods

Marker search and phylogenetic analysis were performed on a sample of 388 genomes of B. anthracis strains: 322 from the GenBank collection (RefSeq), 66 from the collection of pathogenic microorganism genomes of the Stavropol Anti-Plague Institute, described earlier [12]. Genome numbers are given in Appendix 1 on the journal website (https://doi.org/10.36233/0372-9311-487-s1). Genomic sequences of B. anthracis strains from the collection of the Stavropol Anti-Plague Institute have been deposited in the “National Interactive Catalog of Pathogenic Microorganisms and Biotoxins” (State Scientific Center for Applied Microbiology and Biotechnology).

Markers were searched with the help of an algorithm (Pipeline) consisting of pairwise alignment of complete genomes to a reference sequence using the Mauve program and subsequently, with the help of the author’s scripts in the Python language, extraction of genetic variants from the alignments, merging and their analysis.

Marker verification and determination of marker lengths were performed in the BLASTn program using flanking sequences or specific primers.

In order to compare phylogenetic groups with genetic markers, a phylogenetic tree was constructed on the basis of core SNP alignment using the Parsnp program from the Harvest suit package with the reference genome of B. anthracis Ames Ancestor (GCF_000008445.1). Positions with the unknown N nucleotide were removed from the core SNPs. The SNPs from the VCF file were then converted to a FASTA file. The phylogenetic tree was constructed in the MEGA XI program using the maximum likelihood method with the Tamura-Nei substitution model [18].

Comparison of the lengths of genetic variants of markers with phylogenetic dendrogram and data visualization were performed in R language environment with ggtree and ggplot2 libraries.

Primers were designed using the Primer-BLAST program and synthesized at the Stavropol Plague Institute.

Sample preparation of B. anthracis cultures was carried out according to MG 1.3.2569-09 “Organization of laboratories using nucleic acid amplification methods when working with material containing microorganisms of pathogenicity groups I-IV”. DNA extraction of B. anthracis was performed using the DNA-Sorb-B kit (ILC).

A representative phylogenetic sample of sequenced strains was used for verification of data obtained by PCR with electrophoretic detection. PCR was performed using the ScreenMix-HS kit (Eurogen). The amount of primers in the reaction was equal to 0.3 μM. The following thermocycling mode was used: the first stage (activation) — 95ºС, 5 min — 1 cycle, the second stage — denaturation 95ºС, 20 s, annealing 60ºС, 20 s, elongation 72ºС, 60 s — 40 cycles, the third stage (final elongation) — 72ºС, 5 min — 1 cycle. Electrophoresis was performed in 2% agarose gel using a 100 bp molecular weight marker (SibEnzyme).

Clustering of data obtained from PCR results with electrophoretic detection was performed using the single (Nearest Point Algorithm) method in Python with the scipy library.

Results and discussion

The study included two main stages. The first stage involved the search and description of marker loci, and the second stage involved experimental confirmation and validation of the typing technique using the found markers.

The algorithm resulted in the following genomic variations: SNP — 25,664, SNR — 14,387, VNTR — 693, INDEL — 14,667.

The search for markers among all found variations was performed stepwise with filtering according to a number of criteria. The difference in the size of variants of variable loci should be at least 15 bp. We selected mainly such loci with at least one genetic variant in the set of B. anthracis strains from the collection of pathogenic microorganisms of the Stavropol Anti-Plague Institute that was different from the variants of other strains. Variable loci already described were excluded. Using the criteria, 537 variable regions were found.

Following this, the frequency of allelic variants of loci of strains in certain genetic lineages was investigated by comparing the lengths of genetic variants of markers with the phylogenetic dendrogram based on SNPs of the bovine genome (Fig. 1). Most of the variant loci were found in only 1 strain or a minimal number of strains. A significant group consisted of variants sharing the major genetic lineages A, B, and C, including the previously found INDEL indE1 of 38 bp in length. [19], which is logical since these are the most evolutionarily distant genetic lineages.

 

Fig. 1. Comparison of the phylogenetic tree and selected markers B. anthracis (some strains with repeated marker patterns were removed).

 

Fifty-six VNTR and INDEL loci were selected (Table 1). The most phylogenetically significant and optimal for electrophoresis were selected from them. Thus, as a result, 9 VNTR markers and 6 INDEL markers most suitable for genotyping were selected (Fig. 1). The peculiarity of the INDELs found lies in the repeats flanking the INDELs, with one of the repeats being included in the deletion and the other not. For this reason, we can assume the formation of a complex structure between DNA strands during replication, which may cause the polymerase complex to mistakenly double the DNA strand by excising part of the sequence. In this case, reverse INDEL insertion is impossible, which likely reduces the effects of homoplasy.

 

Table 1. Description of the identified molecular B. anthracis markers

Marker	Coordinates of the locus in the genome according to the Ames Ancestor reference strain (GCF_000008445.1)	Replicon	The number of the allele variant (the length of the genetic variant, bp)
indS1	1276500–1276764	Chromosome	1 (265, 266), 2 (241)
indS2	1904893–1905267	Chromosome	1 (373–375), 2 (312)
indS3	1944246–1944531	Chromosome	1 (286), 2 (253)
indS4	402388–402715	Chromosome	1 (328), 2 (423–424)
indS5	655408–655662	Chromosome	1 (255), 2 (272, 284–285)
indS6	4691499–4691775	Chromosome	1 (277), 2 (388–389)
vrrS1	1721221–1721733	Chromosome	1 (513), 2 (425)
vrrS2	4489063–4489484	Chromosome	1 (422), 2 (381), 3 (299,307), 4 (217), 5 (258) 6 (338–340)
vrrS3	8316–8860	pXO2	1 (544–546), 2 (301–302), 3 (464), 4 (383)
vrrS4	8916–9269	pXO2	1 (354–355), 2 (263–264), 3 (444), 4 (534), 5 (174)
vrrS5	3155556–3155727	Chromosome	1 (172), 2 (142)
vrrS6	1092722–1092959	Chromosome	1 (238), 2 (198), 3 (318–319), 4 (398), 5 (278)
vrrS7	5088417–5088723	Chromosome	1 (306–307), 2 (190), 3 (229), 4 (385), 5 (346), 6 (268) (385)
vrrS8	5031546–5031803	Chromosome	1 (258, 263–265), 2 (354, 359–366)
vrrS9	3742896–3743541	Chromosome	1 (646), 2 (450)
indNS1	130607–131099	pXO1	1 (454, 456), 2 (494–495)
indNS2	596340–596832	Chromosome	1 (352), 2 (492–493)
indNS3	122138–122690	pXO1	1 (551–555), 2 (485, 487)
indNS4	77192–77540	pXO1	1 (330), 2 (349), 3 (619)
indNS5	482012–482157	Chromosome	1 (146,149), 2 (504)
indNS6	385564–385837	Chromosome	1 (271–276), 2 (305–308)
indNS7	1372136–1372298	Chromosome	1 (163), 2 (181)
indNS8	2559203–2559485	Chromosome	1 (282–284), 2 (335–336)
indNS9	3855034–3855252	Chromosome	1 (219), 2 (231), 3 (239–241)
indNS10	4303573–4303825	Chromosome	1 (253), 2 (310–311)
indNS11	4965875–4966088	Chromosome	1 (214), 2 (321)
indNS12	1209302–1209701	Chromosome	1 (253), 2 (399–401)
indNS13	2728738–2729257	Chromosome	1 (229), 2 (519–520)
indNS14	486258–486638	Chromosome	1 (285), 2 (381)
indNS15	1287411–1287701	Chromosome	1 (201), 2 (291)
indNS16	910496–910796	Chromosome	1 (301), 2 (490,491)
indNS17	2533966–2534193	Chromosome	1 (228), 2 (634–636)
indNS18	2593388–2593616	Chromosome	1 (228–230), 2 (283)
indNS19	3352013–3354229	Chromosome	1 (193,194), 2 (2124), 3 (2207, 2215–2218, 2223)
indNS20	3829833–3830053	Chromosome	1 (220–221), 2 (251)
indNS21	4811428–4811664	Chromosome	1 (236–237), 2 (600, 602)
indNS22	29253–29436	pXO1	1 (184), 2 (269)
indNS24	1146673–1147101	Chromosome	1 (256), 2 (270–272), 3 (427–430)
indNS25	2224848–2225376	Chromosome	1 (270), 2 (418), 3 (529–530, 537)
indNS26	2687438–2687847	Chromosome	1 (240–241), 2 (410,408–410), 3 (429) 4 (580)
indNS27	3304833–3305473	pXO1	1 (245, 257), 2 (640–641)
vrrNS1	226241–226786	Chromosome	1 (545–547), 2 (694, 697–699), 3 (845–847), 4 (997–998), 5 (1146), 6 (1296–1298)
vrrNS2	1333990–1334961	Chromosome	1 (343), 2 (554, 552), 3 (700), 4 (758, 762–763), 5 (779), 6 (971–974), 7 (1182–1183), 8 (1393)
vrrNS3	2014690–2015095	Chromosome	1 (277), 2 (364), 3 (406, 409), 4 (535)
vrrNS4	4233686–4234066	Chromosome	1 (237), 2 (273, 279), 3 (306, 309, 322), 4 (381), 5 (417), 6 (345)
vrrNS5	4351696–4351908	Chromosome	1 (213), 2 (231)
vrrNS6	4598742–4598948	Chromosome	1 (195, 207), 2 (171, 183)
vrrNS7	811781–812154	Chromosome	1 (284), 2 (302), 3 (320), 4 (374), 5 (428), 6 (482)
vrrNS8	1395847–1396186	Chromosome	1 (340), 2 (385)
vrrNS9	1238148–1238579	Chromosome	1 (361, 366), 2 (398), 3 (430–433), 4 (465), 5 (498)
vrrNS10	2264930–2265251	Chromosome	1 (244), 2 (283), 3 (322), 4 (361), 5 (439), 6 (517)
vrrNS11	4352078–4352327	Chromosome	1 (220), 2 (235), 3 (250, 251), 4 (264–266), 5 (295), 6 (310)
vrrNS12	4927425–4927645	Chromosome	1 (181), 2 (221)
vrrNS13	4769700–4770199	Chromosome	1 (499–501), 2 (352–353)
vrrNS15	1151194–1151463	Chromosome	1 (148), 2 (269–270), 3 (291), 4 (392–393, 396), 5 (514, 520)
vrrNS16	2006677–2007157	Chromosome	1 (481), 2 (433, 435–436), 3 (526), 4 (301), 5 (345–347), 6 (390–391), 7 (255–257)

 

The indels indS1 (FAD-binding oxidoreductase gene), indS2 (hypothetical protein gene WP_000829051.1), and indS6 (cell surface protein gene) localized in the protein-coding genes are genomic variations without a shift of reading frame. IndS4 localizes in the region between the GBAA_RS02140 (ABC transporter ATP-binding protein) and GBAA_RS02145 (ABC-F family ATP-binding cassette domain-containing protein) genes. IndS5 localizes in the region between the genes GBAA_RS03470 (hypothetical protein) and GBAA_RS03475 (alanine:cation symporter family protein). Indel indS3 shifts the reading frame of the gene encoding the SPFH/Band 7/PHB domain protein.

The indel indS1 genetic variant with deletion is characteristic of the A.Br.008/009 (Tsiankovskii) cluster. The indel indS2 is unusual in that there are 3 genetic variants of this locus: an insertion and 2 deletion variants. The difference between the two deletions is a shift of 9 nucleotide pairs. One variant is characteristic of the Siberia and Europe canSNP subgroups of the B.Br.001/002 group, the other is characteristic of strains of the B.Br.Kruger group. The indS3 locus variant with deletion is found in strains of the A.Br.Aust94 group, except for strain 9080-G isolated in Georgia and Kanchipuram strain from India. Variants indS4, indS5, indS6 with deletion are found in A.Br.004, A.Br.001 and A.Br.Ames clusters, respectively.

The number of allelic variants of the selected VNTR markers varies from 2 to 6 with repeat lengths ranging from 30 bp to 196 bp (Fig. 1). The vrrS1 locus has a 425-bp variant found in A.Br.008/009 and A.Br.WNA, as well as one unique 337-bp variant specific to strain 228/269. Genetic variants of the vrrS2 locus are found in the A.Br.008/009 and A.Br.Aust94 groups. Two VNTR markers, vrrrS3 and vrrS4, were found on the pXO2 plasmid. Separate genetic variants of vrrS3 are found in A.Br.008/009 (Tsiankovskii), B.Br.KrugerB and main lineage B, respectively. The vrrS4 locus separates the strains into lineages A and B. The 142 bp allelic variant vrrS5 is found simultaneously in strains of lineage B, A.Br.WNA and A.Br.003/004 groups. The vrrS6 variants are characteristic of part of the strains of the A.Br.008/009 group, the A.Br.004 cluster and lineage B. The vrrrS7 307 bp genetic variant is specific for the A.Br.Ames group. The 258 bp vrrS8 variant is specific to the A.Br.Ames and A.Br.001/002 groups. The 646 bp vrrS9 genetic variant is specific for A.Br.Ames strains isolated in North America.

Variable loci can be grouped according to their belonging to certain genetic clusters. For example, variants of indels indS3, indNS27, and VNTR - vrrNS7 have similar belonging to the A.Br.Aust94 group. Indels indS4 and indNS11 are characteristic of A.Br.004, indNS17 and vrrS9 are characteristic of A.Br.Ames strains isolated in North America. Variants indNS5, indNS9, indNS10 are found in strains of the A.Br.Ames and A.Br.001/002 groups.

For the major lineage B, the characteristic loci are indNS1, indNS12, indNS19, indNS2, indNS3, indNS13, indNS14, and vrrNS12. Characteristic loci for both lineages B and C are indNS18, indNS21, indNS4, indNS6, indNS7 and indNS8.

Some of the unselected markers could also be used for typing. For example, vrrNS1 has high variability but a long repeat of 150 bp and a large length difference between the minimum and maximum genetic variant, which is difficult for electrophoretic detection by PCR. The VNTR of vrrrNS15 is variable within the A.Br.008/009 group. The tandem repeats vrrNS16, vrrNS2, vrrNS4 do not have strict specificity.

The primers were selected for the found markers (Table 2) and a PCR protocol with detection of the results by agarose gel electrophoresis was developed (Fig. 2, Fig. 3). The selected markers had a nucleotide sequence length sufficient for reliable determination of genetic variants of loci (Table 3).

 

Table 2. Primers to VNTR and INDEL loci B. anthracis

Name	Forward primer	Reverse prime
indS1	TATTGGGCAGCAGCATTTGG	ATGAGTTGTACGGGACGCAA
indS2	TGGAGGGGTTGTTCAAGCG	GCGTAACTCGGAGACCATGTA
indS3	AGCAACAGAAAAATGGGGCG	AATCGCTCTTGCTTCCCCTT
indS4	AGAAGGAACAAAAGGAAAAGTAGAG	CAACATGCTCGCCCTTCAAT
indS5	GGTCTATACGGCACACTCCA	GCTTCCAATATTCCCCCTCC
indS6	AGCCCCTTCTTTCGGTGTAT	CGATGAAGATGTAAGACAGCCC
vrrS1	TCGTCCTGGAGCATCTTTCA	CCAAATCGCCCCTAGACCAA
vrrS2	GTTGTTTCATACGTCTATCCCCTTC	GTCCTTTTGGACAGCCTCTCTT
vrrS3	ACTGTAGTTGTCCCTACCCTT	AGAAGTACAGGTGGGACAGGA
vrrS4	TTTCCTTGCGATGCTTCAGT	TGCTGGTATAGAGCCATCTGC
vrrS5	AGCAATGTTTAATTCACCATCAAGT	GTACGCTTTAGTCGGAGACGG
vrrS6	AGGAAGCAGGTTAGCGTTGT	GCGCTATGTGGCGTCTTTTC
vrrS7	AGGAACACTGGTTCAGCCTAT	AGCAGGATCGCTTGCTAGAT
vrrS8	CTGCAATTGCCTTCGCCTTT	GCGAAAAAGAGAAAGCGCTAC
vrrS9	ATGAAGGTGTGACATGCCGT	GTGAAGCTGTAATTGTGGCGT

 

Fig. 2. Results of PCR reaction of INDEL loci with detection by electrophoresis.

The font colors of the strains correspond to the canonical lineages according to Fig. 1.

 

Fig. 3. Results of PCR reaction of VNTR loci with detection by electrophoresis.

The font colors of the strains correspond to the canonical lineages according to Fig. 1.

 

Table 3. Lengths of INDEL and VNTR loci according to phylogenetic groups

Markers	Phylogenetic groups
	A.Br. Ames	A.Br. 001/002	A.Br. Aust94	A.Br. 005/006	A.Br. 008/00 (STI)	A.Br. 008/00 (A.Br.125)	A.Br. 008/00 Tsiankovskii	A.Br. 008/009 (228-269)	B.Br. 001/002	B.Br. 001/002 (B.Br.014)
indS1	265	265	265	265	265	241	241	265	265	265
indS2	375	375	375	375	375	375	375	375	375	312
indS3	286	286	253	286	286	286	286	286	286	286
indS4	328	328	328	424	424	424	424	424	424	424
indS5	255	255	285	285	285	285	285	285	285	285
indS6	277	388	388	388	388	388	388	388	388	388
vrrS1	513	513	513	513	425	425	425	337	513	513
vrrS2	422	422	340	422	422	422	422	422	299	299
vrrS3	545	545	545	545	545	545	464	464	383	383
vrrS4	354	354	354	354	354	354	354	354	444	444
vrrS5	172	172	172	172	172	172	172	172	142	142
vrrS6	238	238	238	318	318	318	318	318	278	278
vrrS7	307	346	346	346	346	346	346	346	346	346
vrrS8	258	258	360	360	360	264	360	360	360	360
vrrS9	450	450	450	450	450	450	450	450	450	450

 

Some strains lack the pXO2 plasmid, and accordingly, they also lack the vrrS3 and vrrS4 loci.

As a result of clustering based on the INDEL typing, strains were divided into 6 clusters: A.Br.Ames, A.Br.001/002, A.Br.Aust94, A.Br.008/009 (Tsiankovskii), B.Br.001/002 (B.Br.014), as well as a cluster including representatives of several genetic groups: A.Br.008/009 (STI), A.Br.008/009 (A.Br.125), A.Br.005/006 and B.Br.001/002. The cluster is singled out as a separate group because no specific INDEL markers have been identified for the strains of these lineages (Fig. 4).

 

Fig. 4. Clustering of B. anthracis strains based on VNTR and INDEL typing.

 

As a result of clustering based on VNTR-typing, strains were divided into 9 clusters: A.Br.Ames, A.Br.001 /002, A.Br.Aust94, A.Br.005/006, A.Br.008/009 (Tsiankovskii), A.Br.008/009 (STI), A.Br.008/009 (A.Br.125), A.Br.008/009 (strain 228/269), B.Br.001/002 (Fig. 4). Strain 228/269 is a member of the A.Br.008/009 (Tsiankovskii) group.

The discriminatory power determined using the Hanter–Gaston diversity index [20] was 0.7 for canSNP typing, and 0.79 and 0.84 for typing based on the analysis of new VNTR and INDEL markers, respectively.

Conclusion

Thus, as a result of genome analysis of 388 B. anthracis strains, variable regions were identified and characterized. New VNTR- and INDEL-markers were found and their binding to clusters of global phylogeny was studied. The developed protocol for marker identification by PCR with electrophoretic visualization of the results allows reliable determination of allelic variants of markers. The found 9 VNTR markers and 6 INDEL markers allow to divide B. anthracis strains into 6 and 9 genetic groups when typing with separate analysis of these markers and into 10 groups when analyzing them together. The genotyping technique based on the analysis of new VNTR- and INDEL-markers is recommended to be used jointly or separately as an addition to the existing genotyping schemes. The use of the developed methodology for the identification of variable VNTR- and INDEL-loci allows reliable determination of the phylogenetic position of B. anthracis strains and is promising for use in the epidemiologic investigation of anthrax outbreaks.

About the authors

Grigorii A. Pechkovskii

Stavropol Plague Control Research Institute

Author for correspondence.
Email: grigorii.pechkovskii@gmail.com
ORCID iD: 0000-0001-7033-9972
SPIN-code: 8878-3299
Scopus Author ID: 57223328514
ResearcherId: Q-7273-2016

junior researcher, Anthrax laboratory

Russian Federation, Stavropol

Evgeny I. Eremenko

Stavropol Plague Control Research Institute

Email: grigorii.pechkovskii@gmail.com
ORCID iD: 0000-0002-8163-1300

D. Sci. (Med.), Professor, principal researcher, Anthrax laboratory

Russian Federation, Stavropol

Alla G. Ryazanova

Stavropol Plague Control Research Institute

Email: grigorii.pechkovskii@gmail.com
ORCID iD: 0000-0002-5196-784X

Cand. Sci. (Med.), Head, Anthrax laboratory

Russian Federation, Stavropol

Sergey V. Pisarenko

Stavropol Plague Control Research Institute

Email: grigorii.pechkovskii@gmail.com
ORCID iD: 0000-0001-6458-6790

Cand. Sci. (Chem.), leading researcher, Laboratory of biochemistry

Russian Federation, Stavropol

Nikolay A. Shapakov

Stavropol Plague Control Research Institute

Email: grigorii.pechkovskii@gmail.com
ORCID iD: 0000-0001-9152-4026

junior researcher, Laboratory of biochemistry

Russian Federation, Stavropol

Lyudmila Yu. Aksenova

Stavropol Plague Control Research Institute

Email: grigorii.pechkovskii@gmail.com
ORCID iD: 0000-0002-7744-3112

Cand. Sci. (Med.), senior researcher, Anthrax laboratory

Russian Federation, Stavropol

Olga V. Semenova

Stavropol Plague Control Research Institute

Email: grigorii.pechkovskii@gmail.com
ORCID iD: 0000-0003-0274-898X

Cand. Sci. (Biol.), researcher, Anthrax laboratory

Russian Federation, Stavropol

Lyudmila D. Timchenko

North-Caucasus Federal University

Email: grigorii.pechkovskii@gmail.com
ORCID iD: 0000-0003-2011-880X

D. Sci. (Vet.), Professor, principal researcher, Interdepartmental scientific and educational laboratory of experimental immunomorphology, immunopathology and immunobiotechnology

Russian Federation, Stavropol

Alexander N. Kulichenko

Stavropol Plague Control Research Institute

Email: grigorii.pechkovskii@gmail.com
ORCID iD: 0000-0002-9362-3949

D. Sci. (Med.), Professor, Academician of RAS, Director

Russian Federation, Stavropol

References

Supplementary files