Spectrum and functional properties of ERG11 gene mutations in fluconazole-resistant Candida albicans strains isolated from HIV-infected patients

Full Text

Introduction

The widespread use of fluconazole in the prevention and treatment of Candida infection, especially among immunocompromised individuals, promoted the resistance to azole antimycotics among fungi of the genus Candida [1, 2]. Candida spp. frequently display overexpression of genes encoding the synthesis of the antimycotic drug target. An important role belongs to the ERG11 gene encoding lanosterol 14-α-demethylase. This enzyme participates in the final step of the synthesis of ergosterol – an integral part of the fungal cell membrane and the target of azole antimycotics. Overexpression of the ERG11 gene results in elevated ergosterol synthesis, thus decreasing the Candida species sensitivity to therapeutic dosages of antimycotics [3]. At the same time, fluconazole can promote the development of the mechanism of microbial drug resistance [4], which, in its turn, is especially high against short-chain azoles like fluconazole [5].

A number of mutations detected in the ERG11 gene can modify the effects of its overexpression to a certain extent. They were associated both with an increase and with a decrease in resistance to azoles [6–10]. However, the findings reported by different laboratories and countries are highly contradictory.

The purpose of the study is to explore the spectrum and functional properties of ERG11 gene mutations in fluconazole-resistant C. albicans strains isolated from HIV-infected patients.

Materials and methods

The study was performed using 10 C. albicans strains inherently resistant to fluconazole and voriconazole from the collection of the Gabrichevsky Moscow Research Institute of Epidemiology and Microbiology of Rospotrebnadzor.

C. albicans strains were assessed by:

• the level of expression and the presence of mutations in the ERG11 gene encoding lanosterol 14-α-demethylase;
• sensitivity to a number of antimycotic drugs belonging to triazole, echinocandin, polyene, and pyrimidine groups.

The C. albicans strains were isolated from the oropharynx of HIV-infected patients aged 20–69 years, having clinical manifestations of oropharyngeal candidiasis and undergoing treatment in Infectious Disease Clinical Hospital No. 2 in Moscow. HIV infection in all the patients was diagnosed using clinical and epidemiological data and confirmed by the detection of specific antibodies/antigens using enzyme immunoassay and lysate-based immunoblot assay for antibodies against human immunodeficiency virus proteins (Profiblot 48 TECAN, AutoBlot 3000) in accordance with the clinical classification of HIV infection¹. All the participating patients signed their informed consent allowing the use of the laboratory test data for scientific purposes. All studies were carried out with the approval of the Ethics Committee of the South Ural State Medical University (minutes No. 4, 25/4/2014) in accordance with the requirements of the Declaration of Helsinki adopted by the World Medical Association in 1964 and outlining the ethical principles for medical research involving human subjects.

Identification of C. albicans species was performed using different methods:

1. Approximate differentiation of fungi by colony color after incubation on specific chromogenic media (Oxoid, HiMedia) at 37ºC for 24–48 hours in accordance with the manufacturer’s instruction;
2. Assessment of biochemical activity following the incubation of standardized cell suspensions in the wells of plates of the Remel RapID YEAST PLUS and ErbaLachema commercial biochemical test systems at 37ºC in accordance with the manufacturer’s instruction. The results were measured visually or semi-automatically in each well and interpreted in accordance with the manufacturer's instruction or using the respective software.
3. Real-time multiplex polymerase chain reaction (real-time PCR) using the AmpliSens C.albicans/ C. glabrata/C. krusei — MULTIPRIME-FL reagent kit for simultaneous hybridization-fluorescence detection of C. albicans, C. glabrata, and C. krusei DNA. DNA was extracted from Candida spp. pure cultures using DNA-sorb-AM reagent kits (Central Research Institute of Epidemiology of Rospotrebnadzor) in accordance with the manufacturer's instruction. The Applied Biosystems 7500 Real Time PCR System was used for amplification.

The sensitivity to echinocandins (anidulafungin, micafungin, caspofungin), azoles (posaconazole, voriconazole, itraconazole, fluconazole), amphotericin B, and 5-flucytosine was evaluated. The analysis was performed in accordance with the recommendations issued by the Interregional Association for Clinical Microbiology and Antimicrobial Chemotherapy for testing sensitivity of microorganisms to antimicrobial agents with reference to CLSI M44 and M60 standards for Candida spp. as well as standards and criteria of the European Committee on Antimicrobial Susceptibility Testing for the microdilution method and bacterial cultures².

The minimum inhibitory concentration of the agent (MIC; mg/ml) was measured by serial microdilutions using Sensititre YeastOne10 plates (Trek Diagnostic System) in accordance with the manufacturer's instruction. The inoculum was prepared in the similar way as for the

disk diffusion method, then it was placed into the modified RPMI-1640 medium and distributed into 96-well plates containing serial microdilutions of antimycotic substances [11]. The results were measured visually by comparing with the growth in the positive control well in accordance with the criteria of the European Committee on Antimicrobial Susceptibility Testing [12].

Levels of ERG11 gene expression were measured by quantitative PCR and the 2^-ΔΔCT method [13]. RNA was extracted from a pure daily culture of the studied strain using the ExtractRNA reagent (Evrogen) in accordance with the manufacturer's instruction. The reverse transcription was carried out using the Reverta-L kit (Central Research Institute of Epidemiology of Rospotrebnadzor) in accordance with the manufacturer's instruction: 30 min at 37ºC. The following primers were used for PCR:

ERG11:

• F — aactacttttgtttataatttaagatggactattga;
• R — aatgatttctgctggttcagtaggt;

PMA1:

• F — ttgaagatgaccacccaatcc;
• R — gaaacctctggaagcaaattgg;

ACT1:

• F — ttggtgatgaagcccaatcc;
• R — catatcgtcccagttggaaaca.

The amplification was performed using the reagent kit for real-time PCR in the presence of Sybr-Green I intercalating dyes (Syntol) and the Applied Biosystems 7500 Real Time PCR System in accordance with the following parameters: 95ºC, 3 min; 40 cycles at 95ºC, 10 sec, 55ºC, 20 sec.

The ACT and PMA housekeeping genes were used as control genes. The reference 2^−ΔΔCT values for the ERG11 gene were obtained by analyzing sensitive isolates (n = 7). The expression level of the studied strain was considered significantly increased, if it was higher than the reference mean values for sensitive isolates (m) by more than 3 standard deviations (3σ).

For Sanger sequencing of the ERG11 gene [14], the following primers were used:

ERG11-1:

• F — atggctattgttgaaactgtcatt;
• R — ggatcaatatcaccacgttctc;

ERG11-2:

• F — attggagacgtgatgctgctcaa;
• R — ccaaatgatttctgctggttcagt.

The ERG11 gene was amplified for sequencing using the Qiagen PCR Master Mix, 2x reagent kit and the Applied Biosystems Veriti thermal cycler in accordance with the protocol: 95ºC for 15 min; 35 cycles at 95ºC for 40 sec, 60ºC for 40 sec, 72ºC for 1.5 min; then at 72ºC for 10 min. The PCR products were purified using the ExoSAP-IT kit (Thermo Fisher Scientific Inc.) in accordance with the manufacturer's instruction. The sequencing reaction was performed with the BigDye Terminator Cycle Sequencing Kit (Applied Biosystems) and the following parameters: 95ºC for 15 min, 35 cycles at 95ºC for 15 sec, 55ºC for 15 sec, 72ºC for 30 sec; 72ºC for 7 min. The products were further purified using the BigDye Xterminator Purification Kit (Applied Biosystems); the Applied Biosystems 3500 genetic analyzer (Applied Biosystems) was used for sequencing.

Microsoft Excel, SciPy [15], Matplotlib [16] software was used for the statistical analysis and data visualization. The significance of differences between groups was assessed using Fisher’s exact test for categorical variables and the Mann-Whitney U test for continuous variables. The significance level for the statistical hypothesis test was set at p < 0.05, the value universally practiced in medical research. The strength of relationships between variables was measured using the Pearson correlation coefficient.

Results

The study showed that 7 (70%) C. albicans strains had 5 mutations in the ERG11 gene, which were identified as E266D, G464S, I471L, D116E, and V488I. The highest frequency of occurrence was demonstrated by the E266D mutation, while the I471L mutation was detected most rarely (Table 1). The total number of mutations was 13.

 

Table 1. Mutations identified in the ERG11 gene

Mutation	Abs.	%
E266D	4	40
G464S	2	20
I471L	1	10
D116E	3	30
V488I	3	30

 

Compound, two-component mutations were carried by 6 (92.3%) strains (Table 2). The highest tendency toward forming compound mutations was demonstrated by E266D and V488I – 3 (30%) mutations in each. No noticeable association between mutations was observed — the correlation coefficient was 0.410 or lower.

 

Table 2. Associations of mutations identified in the ERG11 gene

Mutation	Abs.	%	Аssociation coefficient
E266D + G464S	1	10	0,100
E266D + D116E	2	20	0,356
E266D + V488I	1	10	0,089
V488I + I471L	1	10	0,409
V488I + D116E	1	10	0,045

 

Overexpression of the ERG11 gene was detected in 60% of the tested C. albicans strains. The detected mutations occurred much more frequently in strains with overexpression of the above gene (Table 3). In the meantime, the statistical analysis did not reveal any significant associations between them. At the same time, the V488I mutation demonstrated a strong negative relationship with the overexpression of the ERG11 gene (r = –0.845; p < 0.05).

 

Table 3. Association of mutations in the ERG11 gene with its hyperexpression

Mutation	Strains with overexpression of the gene		Strains without overexpression of the gene		Аssociation coefficient
	abs.	%	abs.	%
E266D	3	75,0	1	25,0	0,251
G464S	1	50,0	1	50,0	0,457
I471L	1	100,0	0	0,0	–
D116E	2	66,7	1	33,3	0,094
V488I	1	33,3	2	66,7	–0,845
The sum	8	61,5	5	38,5	0,089
Combined	4	66,7	2	33,3	0,251

 

The results of the analysis of the association between the mutations and the sensitivity to antimycotic agents are presented in Table 4, showing that MIC in strains carrying some mutation was approximately equal to or significantly lower than MIC in strains without mutations. The noticeably significant difference was demonstrated by the sensitivity to azole antimycotics, MIC of which was 100 times lower in mutation carriers (p < 0.05) compared to the strains without mutations.

 

Table 4. Relationship of mutations in the ERG11 gene with the sensitivity of C. albicans to antimycotic drugs

Mutation		n	Anidulafungin	Micafungin	Caspofungin	Posaconasole	Voriconasole	Itraconazole	Fluconazole	Amphotericin В	5-Flucitosine
The sum	+	12	0,03 ± 0,003	0,012 ± 0,001	0,08 ± 0,009	0,043 ± 0,019	1,083 ± 0,393	0,082 ± 0,038	33,333 ± 10,130	0,708 ± 0,074	0,065 ± 0,005
	–	28	0,041 ± 0,003	0,013 ± 0,001	0,086 ± 0,006	3,471 ± 1,117	4,036 ± 1,067	6,941 ± 2,234	98,857 ± 20,285	0,768 ± 0,048	0,066 ± 0,004
E266D	+	4	0,026 ± 0,004	0,012 ± 0,002	0,075 ± 0,015	0,023 ± 0,004	1,375 ± 0,875	0,038 ± 0,008	28,00 ± 12,000	0,75 ± 0,144	0,06 ± 0,000
	–	6	0,045 ± 0,007	0,013 ± 0,001	0,09 ± 0,013	4,057 ± 2,716	4,333 ± 2,635	8,113 ± 5,432	113,333 ± 48,637	0,75 ± 0,112	0,07 ± 0,010
G464S	+	2	0,045 ± 0,015	0,012 ± 0,004	0,12 ± 0,000	0,133 ± 0,118	2,25 ± 1,750	0,265 ± 0,235	96,00 ± 32,000	1,00 ± 0,000	0,06 ± 0,000
	–	8	0,036 ± 0,006	0,012 ± 0,001	0,075 ± 0,010	3,021 ± 2,100	3,375 ± 2,028	6,038 ± 4,201	75,00 ± 39,509	0,688 ± 0,091	0,068 ± 0,007
D116E	+	3	0,025 ± 0,005	0,01 ± 0,002	0,06 ± 0,000	0,03 ± 0,000	0,50 ± 0,000	0,05 ± 0,010	16,00 ± 0,000	0,667 ± 0,167	0,06 ± 0,000
	–	7	0,043 ± 0,006	0,013 ± 0,001	0,094 ± 0,012	3,477 ± 2,368	4,286 ± 2,228	6,954 ± 4,735	106,286 ± 41,705	0,786 ± 0,101	0,069 ± 0,009
V488I	+	3	0,03 ± 0,000	0,013 ± 0,002	0,08 ± 0,020	0,025 ± 0,005	0,50 ± 0,000	0,05 ± 0,010	16,00 ± 0,000	0,50 ± 0,000	0,08 ± 0,020
	–	7	0,041 ± 0,007	0,012 ± 0,001	0,086 ± 0,012	3,479 ± 2,367	4,286 ± 2,228	6,954 ± 4,735	106,286 ± 41,705	0,857 ± 0,092	0,06 ± 0,000

Note. "+" — mutation is present, "–" — mutation is absent.

 

Among triazoles, significant differences were demonstrated by posaconazole and itraconazole, MIC of which in mutation carriers was 100 times as low (p < 0.05) as MIC in strains without mutations in the ERG11 gene. Furthermore, MIC of these agents was on average 16.5 times as low as MIC of voriconazole and fluconazole (p < 0.001). Among the detected mutations, the G464S mutation deserves close attention: In its carriers, MIC of triazoles decreased less significantly than with other mutations (p < 0.05). The correlation analysis did not reveal any relationship between the chemical structure and molecular weight of the triazole agent and the presence of mutations.

The presence of mutations in the ERG11 gene did not have any significant effect on MICs of the tested echinocandins, amphotericin B, and 5-flucytosine. However, in carriers of the G464S mutation, MICs of anidulafungin, caspofungin, and amphotericin B tended to shift insignificantly towards resistance (p > 0.05).

Discussion

During our molecular and genetic study of C. albicans strains that were inherently resistant to fluconazole and voriconazole, we detected high occurrence of overexpression of the ERG11 gene as well as a number of mutations in the above gene: D116E, E266D, G464S, I471L, and V488I. The E266D mutation was most frequently detected in our subset of C. albicans. The above mutations were described previously; however, they are not ubiquitous [17–26]. Since all strains were viable, we concluded that the location of these mutations did not affect critical regions of the genome, and they were not lethal.

Hypothetically, the gene overexpression must create favorable conditions for mutation or recombination process. However, as our findings show, the mutations in the ERG11 gene are not associated with its overexpression. Moreover, in most cases, the overexpression of the gene and its V488I mutation occurred discordantly. We can assume that the occurrence of the V488I mutation disables the ability of the gene to multiply.

One of the characteristics of the detected mutations was their co-occurrence. The co-occurrence of E266D and G464S mutations was previously described by researchers from China, the Unites States, and some other countries [7, 20, 25, 27–30]. In the meantime, based on the low likelihood of the linkage between individual mutations, the above co-occurrence should be seen as a random event. It means that, most likely, mutations are not linked with each other, i.e. they emerge independently in various regions of the gene, and their location does not depend on anything.

The continuous use of azole agents in treatment of HIV-infected patients with oropharyngeal candidiasis puts strong pressure on the C. albicans population, which starts accumulating resistant strains, including strains with overexpression of the ERG11 gene. Functionally, this mechanism promotes the synthesis of the azole target. At the same time, nonsynonymous mutations in the ERG11 gene lead to modification of the target molecule and, consequently, to altered affinity of antifungal agents to their target [21]. As a result, the effects of gene overexpression are reduced. This phenomenon was pointed out when strains with mutations D116E, G464S, and E266D were studied [5–7, 9, 10, 17, 22, 24, 31–36]; these mutations were found to be associated with a manifold increase in MIC of azole agents. At the same time, the V488I mutation as well as E266D and D116E, as demonstrated by some studied, remained neutral and had no effect on MIC [4–6, 9, 32, 37]. It is believed that this mechanism may remain idle if overexpression of the ERG11 gene is absent [20].

Compared to studies of other researchers cited above, all the mutations detected in our study were associated with increased sensitivity to triazole agents unlike the strains without mutations, though the tested C. albicans strains were resistant. Only the G464S mutation was slightly slow in manifestation of these properties. It can be assumed that the detected mutations significantly affected the structure of the site of interaction between the target molecule and triazoles, which reduced their affinity. At the same time, we did not find any association between MIC in mutant strains and the chemical structure of the therapeutic agent, though overexpression of the ERG11 gene was more efficient against short-chain azoles [3]. The detected mutations had no effect on the sensitivity of the tested strains to echinocandins, amphotericin B, and 5-flucytosine.

In our study, mutant C. albicans strains showed higher sensitivity to itraconazole and posaconazole than to voriconazole and fluconazole. This difference may be associated with the rare administration of the first two drugs for treatment of HIV-infected patients and with the targeted selection of strains by their resistance to the last two drugs.

Thus, most of the studied C. albicans strains, which are resistant to fluconazole and voriconazole, had mutations in the ERG11 gene: D116E, E266D, G464S, I471L, and V488I, which, except for the V488I mutation, are not associated with the overexpression of the above gene. The detected mutations decreased the effects of ERG11 gene overexpression up to 100 times, though they did not eliminate the inherent resistance to triazole antimycotics and did not affect the sensitivity to echinocandins, amphotericin B, and 5-flucytosine.

It should be remembered that the studied strains were isolated from HIV-infected patients – permanent residents of Moscow. Therefore, the obtained results should be interpreted taking into account the specific features of the Moscow Region. The absence of any firm conclusion about the effects of ERG11 gene mutations necessitates further research, including clinical studies.

Conclusions

1. D116E, E266D, G464S, I471L, and V488I mutations are detected in the ERG11 gene in C. albicans strains isolated from HIV-infected patients – residents of Moscow.
2. Except for V488I, the detected mutations do not have any association with the ERG11 gene overexpression.
3. C. albicans strains – mutation carriers – were up to 100 times more sensitive to triazole antimycotics. The presence of mutations had no effect on the sensitivity to echinocandins, polyene, and pyrimidine.

 

Ethics approval. The study was conducted with the informed consent of the patients. The research protocol was approved by the Ethics Committee of the South Ural State Medical University (protocol No. 4, April 25, 2014).

Funding source. This study was not supported by any external sources of funding.

Conflict of interest. The authors declare no apparent or potential conflicts of interest related to the publication of this article.

Author contribution. Аll authors made a substantial contribution to the conception of the work, acquisition, analysis, interpretation of data for the work, drafting and revising the work, final approval of the version to be published.

¹ Russian clinical classification of HIV infection. URL: https://base.garant.ru/12145892 (In Russ.)

² Interregional Association for Clinical Microbiology and Antimicrobial Chemotherapy. Determination of the sensitivity of microorganisms to antimicrobial drugs: Recommendations. 2021. URL: https://www.antibiotic.ru/minzdrav/category/clinical-recommendations/

About the authors

Yuri V. Nesvizhsky

I.M. Sechenov First Moscow State Medical University (Sechenov University); G.N. Gabrichevsky Moscow Research Institute for Epidemiology and Microbiology

Author for correspondence.
Email: nesviz@mail.ru
ORCID iD: 0000-0003-0386-3883

D. Sci. (Med.), Professor, Department of Microbiology, Virology and Immunology, I.M. Sechenov First Moscow State Medical University (Sechenov University); Chief Researcher, G.N. Gabrichevsky Research Institute for Epidemiology and Microbiology

Россия, Moscow; Moscow

Stanislav S. Afanasiev

G.N. Gabrichevsky Moscow Research Institute for Epidemiology and Microbiology

Email: nesviz@mail.ru
ORCID iD: 0000-0001-6497-1795

D. Sci. (Med.), Professor, Main Researcher

Россия, Moscow

Alexander D. Voropaev

I.M. Sechenov First Moscow State Medical University (Sechenov University)

Email: nesviz@mail.ru
ORCID iD: 0000-0002-6431-811X

Postgraduate Student

Россия, Moscow

Yulia N. Urban

G.N. Gabrichevsky Moscow Research Institute for Epidemiology and Microbiology

Email: nesviz@mail.ru
ORCID iD: 0000-0003-0189-3608

Сand. Sci. (Biol.), Senior Researcher, Laboratory of Clinical Microbiology and Biotechnology

Россия, Moscow

Mariam E. Suleimanova

Petrovsky National Research Center of Surgery

Email: nesviz@mail.ru
ORCID iD: 0000-0002-9255-6481

Resident

Россия, Moscow

Maxim S. Afanasiev

I.M. Sechenov First Moscow State Medical University (Sechenov University)

Email: nesviz@mail.ru
ORCID iD: 0000-0002-5860-4152

D. Sci. (Med.), Professor, Chair of Clinical Allergology and Immunology

Россия, Moscow

Elena V. Budanova

I.M. Sechenov First Moscow State Medical University (Sechenov University)

Email: nesviz@mail.ru
ORCID iD: 0000-0003-1864-5635

Cand. Sci. (Med.), Associated Professor

Россия, Moscow

Elena A. Voropaeva

G.N. Gabrichevsky Moscow Research Institute for Epidemiology and Microbiology

Email: nesviz@mail.ru
ORCID iD: 0000-0002-0463-0136

D. Sci. (Biol.)

Россия, Moscow

References

Supplementary files