Impact of ESBL and MBL-producing Pseudomonas aeruginosa on Caenorhabditis elegans: assessing survival, reproductive fitness, chemotaxis behaviour, and gene expression

Cover Image


Cite item

Full Text

Abstract

Introduction. Nematode Caenorhabditis elegans is a key model for studying host–pathogen interactions. In our study, we explored the impact of extended-spectrum beta-lactamase (ESBL) and metallo-beta-lactamase (MBL) producing strains of Pseudomonas aeruginosa on C. elegans, examining survival, reproductive fitness, chemotaxis behaviour, and gene expression. Both ESBL and MBL-producing P. aeruginosa showed a slow killing phenotype in C. elegans, with prolonged gut colonization and reduced lifespan compared to worms fed Escherichia coli OP50.

Materials and methods. C. elegans N2 strain was exposed to ESBL/MBL-producing P. aeruginosa strains, non-resistant P. aeruginosa, and E. coli OP50. Survival, reproductive fitness, chemotaxis, and gene expression of daf-16 and age-1 were analyzed via assays and qRT-PCR.

Results. Resistant strains caused accelerated mortality, starting on day 2, while non-resistant strains had delayed mortality from day 5. This indicates that ESBL and MBL enzymes may boost P. aeruginosa's virulence. Worms exposed to these resistant strains had reduced fecundity, showing impaired reproductive fitness. Changes in chemotaxis behaviour suggested that virulence factors and quorum sensing might affect how worms seek food. Gene expression analysis revealed significant changes in daf-16, a gene involved in stress resistance and immunity, in response to ESBL and MBL strains. However, there were no significant differences in the expression of age-1, indicating other mechanisms at play besides insulin/insulin-like growth factor signalling.

Conclusion. This study highlights the complex interactions between bacterial virulence, host survival, and reproductive behaviour. By exploring the effects of antibiotic resistance on C. elegans, we offer insights into the broader implications of antibiotic-resistant infections and potential strategies for managing them.

Full Text

Introduction

The ongoing quest for novel targets in antimicrobial therapy has led to a growing demand for cost-effective [1] and high-throughput in vivo model systems, aimed at reducing reliance on animal models for preclinical efficacy and toxicity evaluations. At a molecular level there is still a great deal to learn about interactions between animals and pathogens [2]. Furthermore, when employing mammals as the hosts, it is difficult to genetically dissect the host routes that are especially targeted by bacterial virulence factors due to the lack of a genetically tractable metazoan system to research [3]. Therefore, a straightforward model host for examining the relationship between bacterial pathogens like Pseudomonas aeruginosa and the metazoan innate immune system is the worm Caenorhabditis elegans [4].

P. aeruginosa, known for its adaptability, is an opportunistic pathogen capable of causing both chronic and acute infections, and is recognized as a leading cause of nosocomial infections [5, 6]. Because of the organism's proclivity to express a wide variety of virulence factors, adapt quickly to environmental changes, and gain antibiotic resistance, P. aeruginosa infections are well known to dramatically raise a possibility of morbidity and mortality [7]. The pathogenicity of P. aeruginosa stems from its extensive array of virulence factors and antibiotic-resistant mechanisms encoded in its genome [8, 9]. This genetic diversity enables it to adapt to various environments, including host immune responses, leading to significant morbidity and mortality, particularly with the emergence of multidrug-resistant strains [10, 11]. Recent studies have identified frequent occurrences of P. aeruginosa strains carrying ESBL and MBL genes, posing significant challenges for antibiotic treatment [12].

Understanding the interactions between P. aeruginosa and the host is vital for developing effective treatments and vaccines. However, these interactions remain poorly understood, highlighting the need to delve into the pathogen-host interaction at the cellular and molecular levels [13, 14]. Employing a forthright and genetically tractable host like C. elegans, then we should be able to simulate some aspects of mammalian pathogenesis [2].

Significantly, C. elegans' tiny size and brief lifetime firmly establish its usefulness as a model organism. Most importantly, in comparison with fruit flies and mouse models, C. elegans is a self-fertilized organism, and all of its progeny are genetically identical [15]. C. elegans has been utilised as an in vivo infection paradigm to examine the intricate host-pathogen interaction and the evolutionarily conserved processes employed by pathogens to infect and destroy the host [16]. The genome of the eukaryotic creature C. elegans was the first to be completely sequenced. C. elegans stands as the pioneer and sole multicellular organism to have its complete cell lineage mapped, encompassing 959 somatic cells, including 302 neurons [17]. C. elegans is a 1 mm long, transparent, free-living worm that grows from an egg to adulthood in under three days at 20°C. The short lifetime and rapid generation time speed the antibacterial discovery process and greatly encourage its automation [18]. When given pathogenic bacterial cells, the C. elegans worms quickly display illness and death, mimicking human innate immunity [19, 20]. C. elegans is an outstanding model organism capable of traversing the discrepancy between in vitro experiments and the intricacies of vertebrate models [21]. Identification and study of bacterial virulence and host defence components are made possible by potent genetic and molecular techniques in C. elegans and P. aeruginosa [18, 22].

This study endeavours to investigate the combined impact of MBL and ESBL Pseudomonas isolates on host reproductive fitness, chemotaxis behaviour, and gene expression patterns. Through this method of analysis, we want to illustrate the intricate dynamics of host-pathogen relationships, highlighting the link between host vulnerability, host behaviour, and bacterial virulence. By uncovering the mechanisms behind the pathogenicity of ESBL and MBL-producing P. aeruginosa isolates, our goal is to enhance our understanding of antibiotic resistance and its implications for host health. Additionally, our results emphasize the importance of utilizing C. elegans as a model system to investigate these interactions and assess antimicrobial interventions.

Methods

Isolation of Pseudomonas aeruginosa and detection of virulence genes

Seven ESBL and MBL positive P. aeruginosa isolates from patients with urinary tract infections (UTI) had been collected from tertiary care hospital. The samples had been subjected to virulence genotyping by polymerase chain reaction (PCR) analysis and antibiotic sensitivity testing to confirm ESBL and MBL mediated resistance in P. aeruginosa isolates. This study evaluates the gene coding for one of the main virulence factors — toxA in P. aeruginosa isolates detected in UTI patients. DNA was extracted from ESBL and MBL positive P. aeruginosa uroisolates using the boiling lysis technique.

Nematode strain

S. elegans (N2 Bristol) wild type strain was utilized in this study. Worms were transferred to E. coli OP50 lawn plates using a worm picker and incubated at 20°C in a BOD incubator. Upon depletion of food, worms were transferred to fresh plates and allowed to grow for 3–4 days. Synchronized eggs were obtained following the protocol by Sulston and Hodgkin (1988). These synchronized eggs were seeded onto NGM plates with E. coli OP50 lawns and observed under a light microscope for verification before being incubated at 20℃ in a BOD incubator.

Preparation of NGM plates for C. elegans — P. aeruginosa assays

Agar-based “slow-killing” takes place on modified C. elegans NGM media and is the most commonly used C. elegans — P. aeruginosa assays. Isolated colonies were inoculated in NGM broth and incubated at 37°C for 24 hours. After 24 hours lawn culture was made on the NGM plates using 5 µl of culture that was adjusted to 0.5 using McFarland standard and incubated at 37°C for 24 hours. These were taken as the experimental P. aeruginosa treatment plates. Similarly, the experimental control plates were prepared using the E. coli OP50 bacterial strain. These plates were utilised for exposure of the worms to bacterial strains as their diet and then assayed for survival, colonization, CFU, reproductive ability and gene expression analysis in C. elegans.

Survival assay

Ten synchronized L4 worms were transferred to NGM plate containing the P. aeruginosa and it was incubated at 20°C. The worms were monitored every 24 hours. The worms were scored dead when they did not respond to gentle touch with a needle. Experiments were repeated three times for each isolate. Statistical analysis was done by using Kaplan–Meier survival plot.

Reproduction assay

One synchronized L4 worm were exposed to ESBL and MBL P. aeruginosa isolates, ATCC P. aeruginosa and control E. coli OP50 for 48 hours at 20°C. After 48 hours, the number of eggs laid by the worm was counted. The experiment was performed in triplicates.

Chemotaxis assay

In an unseeded 30 mm NGM agar plate two spots containing the test pathogen and E. coli OP50 were made from 5 µL of NGM broth culture and allowed to grow overnight the young adult worms were transferred to NGM plate with corresponding isolates for treatment (as shown in the figure below) and then incubated at 20°C. After 24 hours the number worms that completely crossed the start circle and reached the bacterial spots were counted. The chemo taxis index was calculated using the formula:

Chemotaxis Index (CI) = (A – B) / (A + B),

where A stands for number of worms in E. coli OP50 and B stands for the pathogen.

RNA isolation and the detection of age-1 and daf-16 genes

Synchronized L4 worms were placed on a 60mm petri plate containing ESBL and MBL P. aeruginosa isolates, ATCC P. aeruginosa, and control E. coli OP50 lawn culture prepared from 10 µL NGM broth culture, and then incubated at 20°C for 24 hours. After incubation, adult worms were washed three times with M9 buffer to remove bacteria and suspended in 750 µL of Trizol solution (GCC Biotech) for RNA isolation, followed by storage at –20°C overnight to several days. RNA isolation was performed using the Trizol method, and the isolated RNA was stored at –80°C until further use. The RNA was quantified using a NanoDrop 2000 spectrophotometer (Thermo Scientific). Subsequently, 1 µg of total isolated RNA was reverse transcribed using the RevertAid First Strand cDNA Synthesis Kit (Thermo), and the obtained cDNA was stored at –20°C. The reaction was performed using SYBR Premix Ex Taq (RR041; Takara), and primers obtained from Eurofins (Table 1), were dissolved in milliQ water to obtain a working concentration of 5 Pmol/µl. Real-time PCR was conducted for age-1, daf-16, and actin as an internal control using the QuanStudio Real-Time PCR 6 Flex System. The reaction included initial denaturation at 95°C for 30 seconds, followed by 40 cycles of denaturation at 95°C for 5 seconds, annealing, and extension at 58°C for 30 seconds.

 

Table 1. List of primers

Gene

Primer sequence (5' to 3')

Tm, °С

GC content, %

Product size, bp

age-1-F

CGAAAGCGGATTTGGATCATTT

56.53

40.91

151

age-1-R

TGTTTGACTGCGTGGAAGAG

57.30

50.0

daf-16-F

GCGAATCGGTTCCAGCAATTCC

57.4

50

171

daf-16-R

ATCCACGGACACTGTTCAACTC

57.4

50

act-F

CCAGGAATTGCTGATCGTATGC

58

46

133

act-R

TGGAGAGGGAAGCGAGGATAG

56.7

55

 

Statistical analysis

The data collected from the experiments were presented as mean ± standard deviation. Statistical analysis was conducted using one-way analysis of variance (ANOVA), followed by Newman–Keuls test for comparison between control and treated groups. GraphPad Prism v. 5 was employed for statistical analysis. A significance level of p < 0.05 was used to determine statistical significance.

Results

Survival Assay

ESBL and MBL P. aeruginosa isolates showed slow killing of C. elegans through gut colonization, leading to reduced lifespan compared to worms fed on E. coli OP50 (Fig. 1). Death was first recorded on day 2 in worms exposed to resistant isolates, whereas worms exposed to non-resistant strains began dying from day 5, stabilizing by day 7 and continuing through day 12. Control worms fed on E. coli OP50 remained viable throughout the experiment. Data analyzed by Kaplan–Meier survival plots showed significant differences in survival dynamics among groups.

 

Fig. 1. Effect of P. aeruginosa on survival of C. elegans.

 

Colonization Assay

ESBL and MBL isolates exhibited slow killing via gut colonization, likely mediated by quorum sensing and virulence factor production (Fig. 2). Colony-forming units (CFUs) of ESBL, MBL, and drug-sensitive P. aeruginosa isolates were significantly higher than in control worms. Statistical significance was determined using Newman–Keuls test (p < 0.05, p < 0.005, p < 0.001).

 

Fig. 2. Representative bar diagram for colonization assay.

Ordinate: colony-forming units per worm, × 106.

 

Reproduction assay

The reproductive fitness of C. elegans was significantly impaired when exposed to ESBL and MBL isolates (Fig. 3). Affected isolates (P13, P15, P17, P26) significantly reduced reproductive output compared to control worms. No significant difference was observed in P12, P18, and P53. Statistical significance was evaluated using the Newman–Keuls test.

 

Fig. 3. Effect of P. aeruginosa on reproduction of C. elegans.

 

Chemotaxis Assay

Worms exhibited avoidance behavior toward P. aeruginosa odorants compared to E. coli OP50 (Fig. 4). Chemotaxis assays demonstrated that most worms moved toward E. coli, indicating an aversion to virulent Pseudomonas strains. Statistical comparisons showed significant differences (p < 0.05, p < 0.005, p < 0.001).

 

Fig. 4. Chemotaxis behaviour of worms observed on exposure to P. aeruginosa along with control.

 

Expression of daf-16

Expression of the daf-16 gene was significantly altered in worms exposed to P13, P15, and P18 isolates (Fig. 5). This gene, involved in stress resistance and longevity, showed upregulation in certain experimental groups. Statistical analysis confirmed significance across groups compared to controls.

 

Fig. 5. Expression of daf-16 gene on exposure of P. aeruginosa.

 

Expression of age-1

No statistically significant differences were observed in age-1 expression across most isolates, although P18 showed a relatively increased expression level (Fig. 6). This gene plays a role in the insulin/IGF signaling pathway, influencing longevity and stress response in C. elegans.

 

Fig. 6. Expression of age-1 gene on exposure of P. aeruginosa.

 

Discussion

The invertebrate model organism C. elegans offers a unique blend of advantages from both whole animal approaches and in vitro methods. This makes it a promising tool for bridging the inherent gap between in vitro and in vivo approaches [23]. Our study demonstrated that ESBL- and MBL-producing P. aeruginosa isolates induce a slow-killing phenotype in C. elegans, consistent with the earlier findings of M.W. Tan et al., who reported two distinct mechanisms of killing: a "fast-killing" toxin-mediated pathway and a "slow-killing" pathway driven by intestinal colonization and bacterial accumulation [2, 3]. In our experiments, resistant isolates (ESBL and MBL) initiated mortality from Day 2, while drug-sensitive strains began causing death only from day 5. This acceleration in mortality among resistant strains implicates enhanced virulence due to resistance-associated mechanisms—possibly through metabolic rewiring, quorum sensing amplification, or increased expression of virulence factors such as elastases, rhamnolipids, and pyocyanin [24, 25].

Although direct extrapolation to human infection models is limited, our findings raise significant hypotheses for future translational research. For instance, the observed enhanced colonization and mortality suggest that resistance determinants like ESBL and MBL may confer fitness advantages beyond antibiotic evasion, possibly facilitating persistent infections in immunocompromised human hosts. This aligns with clinical reports of multidrug-resistant P. aeruginosa strains showing increased persistence and poorer outcomes in chronic infections, including those in cystic fibrosis, burn wounds, and ventilator-associated pneumonia [26].

Further, the colonization assay confirmed that resistant isolates persist and accumulate at higher levels in the C. elegans gut, indicating potential alterations in biofilm formation, motility, or immune evasion strategies. Quorum sensing genes, which regulate many virulence traits in P. aeruginosa, may play a key role here, and future studies could evaluate the expression of lasR/rhlR systems in this model. The reproductive fitness assay revealed that ESBL and MBL isolates significantly reduced fecundity in C. elegans, indicating a broader systemic effect of bacterial colonization or toxins on host physiology. This impairment mirrors host–microbe interactions in more complex organisms, where infections are known to disrupt endocrine signalling, reproduction, and energy metabolism [27]. Notably, strains P13, P15, P17, and P26 caused significant reductions, suggesting strain-specific virulence profiles. In human terms, these effects may correlate with increased morbidity in vulnerable populations, particularly neonates and individuals with compromised immunity, where P. aeruginosa infection is linked to developmental delays and systemic stress [28]. Our chemotaxis assay adds a behavioral dimension to host-pathogen dynamics. The avoidance behavior exhibited by worms in response to P. aeruginosa odorants supports the hypothesis that virulence factors (e.g., phenazines, siderophores) serve not only as pathogenic tools but also as ecological signals perceived by the host [29]. In clinical settings, similar microbial metabolites may influence microbiota-host interactions in the gut, potentially altering host neural or immune responses. Gene expression analyses provided additional insight into host defense pathways. Notably, daf-16, a central regulator of stress responses, immunity, and longevity in C. elegans, was significantly modulated in response to certain resistant strains (P13, P15, P18). As a homolog of human FOXO transcription factors, DAF-16 modulation suggests that ESBL and MBL-producing strains may activate conserved innate immune pathways. This finding raises potential for future host-targeted therapeutics aimed at modulating FOXO/DAF-16 pathways to boost resilience during multidrug-resistant infections. In contrast, age-1, which acts upstream in the insulin-like signalling pathway, did not show significant expression changes, implying that ESBL/MBL-related pathogenicity may act independently of insulin-mediated longevity signalling. This separation of pathway involvement hints at a more targeted activation of stress or immune-specific mechanisms rather than a global stress response. Further investigation into other immune effectors such as lys-7, sod-3, or ctl-2 could provide a more comprehensive understanding. Although our study shows that ESBL- and MBL-producing P. aeruginosa markedly affected the survival, reproduction, chemotaxis, and daf-16 expression of C. elegans, we acknowledge certain limitations. We did not quantify β-lactamase activity or determine minimum inhibitory concentration (MIC) values, which would allow a clearer correlation between enzyme activity and virulence. ESBL/MBL status was instead confirmed by PCR and antibiogram profiles. Additionally, a limitation of the present study is the absence of clinical P. aeruginosa isolates lacking ESBL and MBL genes as a control group. While we included the ATCC P. aeruginosa strain as a drug-sensitive reference, it may not fully replicate the virulence characteristics of clinical isolates. Inclusion of non-ESBL/MBL clinical isolates in future studies would allow a more precise assessment of the impact of resistance determinants on virulence in C. elegans. Despite these limitations, our findings indicate that ESBL/MBL-positive isolates display enhanced pathogenic traits compared to the reference strains, underscoring the broader role of resistance in host–pathogen interactions.

Conclusion

In conclusion, our study illuminates the intricate dynamics of host-pathogen interactions, highlighting the interplay between bacterial virulence, host susceptibility, and host behaviour. By elucidating the mechanisms driving the pathogenicity of ESBL and MBL-producing P. aeruginosa isolates, we advance our comprehension of antibiotic resistance and its ramifications for host health. Moreover, our findings underscore the significance of utilizing C. elegans as a model system for investigating these interactions and evaluating antimicrobial interventions. This research sheds light on the underlying mechanisms of the increased pathogenicity of ESBL and MBL Pseudomonas isolates, contributing to our broader understanding of antibiotic resistance and facilitating the development of targeted therapeutic strategies against multidrug-resistant infections.

×

About the authors

Janani Nandan

University of Madras

Email: jananinandan2014@gmail.com
ORCID iD: 0009-0000-9232-2784

M.Sc. (medical microbiology), researcher, Department of microbiology, Dr. A.L.M. PG Institute of Basic Medical Sciences

India, Chennai, Tamil Nadu

Anandhakrishnan Rajaram Heamchandsaravanan

University of Madras

Email: heamchand0314@gmail.com
ORCID iD: 0000-0003-3369-2587

M.Sc. (medical microbiology), researcher, Department of microbiology, Dr. A.L.M. PG Institute of Basic Medical Sciences

India, Chennai, Tamil Nadu

Charles Sharchil

University of Madras

Email: andrewchales@gmail.com
ORCID iD: 0000-0001-9055-0951

Ph.D. (Genetics), researcher, Department of genetics, Dr. A.L.M. PG Institute of Basic Medical Sciences

India, Chennai, Tamil Nadu

Vinu Ramachandran

University of Madras

Email: vinutwin@gmail.com
ORCID iD: 0000-0002-8566-7415

Ph.D. (Genetics), researcher, Department of genetics, Dr. A.L.M. PG Institute of Basic Medical Sciences

India, Chennai, Tamil Nadu

Damodharan Perumal

Indira Medical College and Hospitals

Email: 17damzz@gmail.com
ORCID iD: 0000-0001-5318-6513

Ph.D. (Medical microbiology), Assistant Professor, Department of microbiology

India, Pandur, Tamil Nadu

Anandan Balakrishnan

University of Madras

Author for correspondence.
Email: anand_gem@yahoo.com
ORCID iD: 0000-0003-4747-3799

Ph.D. (Genetics), Assistant Professor, Department of genetics, Dr. A.L.M. PG Institute of Basic Medical Sciences

India, Chennai, Tamil Nadu

Prabu Dhandapani

University of Madras

Email: bruibms@gmail.com
ORCID iD: 0000-0003-2866-4338

Ph.D. (Medical microbiology), Assistant Professor and Head i/c, Department of microbiology, Dr. A.L.M. PG Institute of Basic Medical Sciences

India, Chennai, Tamil Nadu

References

  1. Sifri C.D., Begun J., Ausubel F.M. The worm has turned – microbial virulence modeled in Caenorhabditis elegans. Trends Microbiol. 2005;13(3):119–27. DOI: https://doi.org/10.1016/j.tim.2005.01.003
  2. Tan M.W., Mahajan-Miklos S., Ausubel F.M. Killing of Caenorhabditis elegans by Pseudomonas aeruginosa used to model mammalian bacterial pathogenesis. Proc. Natl Acad. Sci. USA. 1999;96(2):715–20. DOI: https://doi.org/10.1073/pnas.96.2.715
  3. Tan M.W., Rahme L.G., Sternberg J.A., et al. Pseudomonas aeruginosa killing of Caenorhabditis elegans used to identify P. aeruginosa virulence factors. Proc. Natl Acad. Sci. U. S. A. 1999;96(5):2408–13. DOI: https://doi.org/10.1073/pnas.96.5.2408
  4. Kirienko N.V., Cezairliyan B.O., Ausubel F.M., Powell J.R. Pseudomonas aeruginosa PA14 pathogenesis in Caenorhabditis elegans. Methods Mol. Biol. 2014;1149:653–69. DOI: https://doi.org/10.1007/978-1-4939-0473-0_50
  5. Heurlier K., Dénervaud V., Haas D. Impact of quorum sensing on fitness of Pseudomonas aeruginosa. Int. J. Med. Microbiol. 2006;296(2-3):93–102. DOI: https://doi.org/10.1016/j.ijmm.2006.01.043
  6. Bradford P.A. Extended-spectrum beta-lactamases in the 21st century: characterization, epidemiology, and detection of this important resistance threat. Clin. Microbiol. Rev. 2001;14(4):933–51. DOI: https://doi.org/10.1128/CMR.14.4.933-951.2001
  7. Ghanem S.M., Abd El-Baky R.M., Abourehab M.A.S., et al. Prevalence of quorum sensing and virulence factor genes among Pseudomonas aeruginosa isolated from patients suffering from different infections and their association with antimicrobial resistance. Infect. Drug Resist. 2023;16:2371–85. DOI: https://doi.org/10.2147/IDR.S403441
  8. Moradali M.F., Ghods S., Rehm B.H. Pseudomonas aeruginosa lifestyle: a paradigm for adaptation, survival, and persistence. Front. Cell Infect. Microbiol. 2017;7:39. DOI: https://doi.org/10.3389/fcimb.2017.00039
  9. Riquelme S.A., Liimatta K., Wong Fok Lung T., et al. Pseudomonas aeruginosa utilizes host-derived itaconate to redirect its metabolism to promote biofilm formation. Cell Metab. 2020;31(6):1091–106.e6. DOI: https://doi.org/10.1016/j.cmet.2020.04.017
  10. Maurice N.M., Bedi B., Sadikot R.T. Pseudomonas aeruginosa biofilms: host response and clinical implications in lung infections. Am. J. Respir. Cell Mol. Biol. 2018;58(4):428–39. DOI: https://doi.org/10.1165/rcmb.2017-0321TR
  11. Edward E.A., El Shehawy M.R., Abouelfetouh A., Aboulmagd E. Prevalence of different virulence factors and their association with antimicrobial resistance among Pseudomonas aeruginosa clinical isolates from Egypt. BMC Microbiol. 2023;23(1):161. DOI: https://doi.org/10.1186/s12866-023-02897-8
  12. Bae I.K., Suh B., Jeong S.H., et al. Molecular epidemiology of Pseudomonas aeruginosa clinical isolates from Korea producing β-lactamases with extended-spectrum activity. Diagn. Microbiol. Infect. Dis. 2014;79(3):373–7. DOI: https://doi.org/10.1016/j.diagmicrobio.2014.03.007
  13. Irazoqui J.E., Troemel E.R., Feinbaum R.L., et al. Distinct pathogenesis and host responses during infection of C. elegans by P. aeruginosa and S. aureus. PLoS Pathog. 2010;6(7):e1000982. DOI: https://doi.org/10.1371/journal.ppat.1000982
  14. Papaioannou E., Utari P.D., Quax W.J. Choosing an appropriate infection model to study quorum sensing inhibition in Pseudomonas infections. Int. J. Mol. Sci. 2013;14(9):19309–40. DOI: https://doi.org/10.3390/ijms140919309
  15. Hoffmann J.A., Kafatos F.C., Janeway C.A., Ezekowitz R.A. Phylogenetic perspectives in innate immunity. Science. 1999;284(5418):1313–8. DOI: https://doi.org/10.1126/science.284.5418.1313
  16. Balla K.M., Troemel E.R. Caenorhabditis elegans as a model for intracellular pathogen infection. Cell. Microbiol. 2013;15(8):1313–22. DOI: https://doi.org/10.1111/cmi.12152
  17. Baumeister R., Schaffitzel E., Hertweck M. Endocrine signaling in Caenorhabditis elegans controls stress response and longevity. J. Endocrinol. 2006;190(2):191–202. DOI: https://doi.org/10.1677/joe.1.06856
  18. Zarroug S.H.O., Bajaman J.S., Hamza F.N., et al. Caenorhabditis elegans as an in vivo model for the discovery and development of natural plant-based antimicrobial compounds. Pharmaceuticals (Basel). 2023;16(8):1070. DOI: https://doi.org/10.3390/ph16081070
  19. Adonizio A., Kong K.F., Mathee K. Inhibition of quorum sensing-controlled virulence factor production in Pseudomonas aeruginosa by South Florida plant extracts. Antimicrob. Agents Chemother. 2008;52(1):198–203. DOI: https://doi.org/10.1128/AAC.00612-07
  20. Kurz C.L., Ewbank J.J. Caenorhabditis elegans: an emerging genetic model for the study of innate immunity. Nat. Rev. Genet. 2003;4(5):380–90. DOI: https://doi.org/10.1038/nrg1067
  21. Irazoqui J.E., Urbach J.M., Ausubel F.M. Evolution of host innate defence: insights from Caenorhabditis elegans and primitive invertebrates. Nat. Rev. Immunol. 2010;10(1):47–58. DOI: https://doi.org/10.1038/nri2689
  22. Mahajan-Miklos S., Tan M.W., Rahme L.G., Ausubel F.M. Molecular mechanisms of bacterial virulence elucidated using a Pseudomonas aeruginosa – Caenorhabditis elegans pathogenesis model. Cell. 1999;96(1):47–56. DOI: https://doi.org/10.1016/s0092-8674(00)80958-7
  23. Wittkowski P., Marx-Stoelting P., Violet N., et al. Caenorhabditis elegans as a promising alternative model for environmental chemical mixture effect assessment – a comparative study. Environ. Sci. Technol. 2019;53(21):12725–33. DOI: https://doi.org/10.1021/acs.est.9b03266
  24. Zečić A., Braeckman B.P. DAF-16/FoxO in Caenorhabditis elegans and its role in metabolic remodeling. Cells. 2020;9(1):109. DOI: https://doi.org/10.3390/cells9010109
  25. Jia K., Thomas C., Akbar M., et al. Autophagy genes protect against Salmonella typhimurium infection and mediate insulin signaling-regulated pathogen resistance. Proc. Natl Acad. Sci. USA. 2009;106(34):14564–9. DOI: https://doi.org/10.1073/pnas.0813319106
  26. Singh V., Aballay A. Regulation of DAF-16-mediated innate immunity in Caenorhabditis elegans. J. Biol. Chem. 2009;284(51):35580–7. DOI: https://doi.org/10.1074/jbc.M109.060905
  27. Lin K., Dorman J.B., Rodan A., Kenyon C. daf-16: An HNF-3/forkhead family member that can function to double the life-span of Caenorhabditis elegans. Science. 1997;278(5341):1319–22. DOI: https://doi.org/10.1126/science.278.5341.1319
  28. Li W.J., Wang C.W., Tao L., et al. Insulin signaling regulates longevity through protein phosphorylation in Caenorhabditis elegans. Nat. Commun. 2021;12(1):4568. DOI: https://doi.org/10.1038/s41467-021-24816-z
  29. Cheng C.L., Gao T.Q., Wang Z., Li D.D. Role of insulin/insulin-like growth factor 1 signaling pathway in longevity. World J. Gastroenterol. 2005;11(13):1891–5. DOI: https://doi.org/10.3748/wjg.v11.i13.1891

Supplementary files

Supplementary Files
Action
1. JATS XML
Download
2. Fig. 1. Effect of P. aeruginosa on survival of C. elegans.

Download (205KB)
Indexing metadata
3. Fig. 2. Representative bar diagram for colonization assay. Ordinate: colony-forming units per worm, × 106.

Download (170KB)
Indexing metadata
4. Fig. 3. Effect of P. aeruginosa on reproduction of C. elegans.

Download (70KB)
Indexing metadata
5. Fig. 4. Chemotaxis behaviour of worms observed on exposure to P. aeruginosa along with control.

Download (57KB)
Indexing metadata
6. Fig. 5. Expression of daf-16 gene on exposure of P. aeruginosa.

Download (369KB)
Indexing metadata
7. Fig. 6. Expression of age-1 gene on exposure of P. aeruginosa.

Download (385KB)
Indexing metadata

Copyright (c) 2025 Nandan J., Heamchandsaravanan A.R., Sharchil C., Ramachandran V., Perumal D., Balakrishnan A., Dhandapani P.

Creative Commons License
This work is licensed under a Creative Commons Attribution 4.0 International License.
СМИ зарегистрировано Федеральной службой по надзору в сфере связи, информационных технологий и массовых коммуникаций (Роскомнадзор).
Регистрационный номер и дата принятия решения о регистрации СМИ: ПИ № ФС77-75442 от 01.04.2019 г.