Impairment of influenza A virus reproduction in vivo with siRNA-induced silencing of the NXF1, PRPS1 and NAA10 cellular genes

Full Text

Introduction

Among infectious diseases affecting the upper respiratory tract and lungs, infections associated with influenza A virus are the most prevalent [1]. Global influenza morbidity reaches 20% of the population per year, with a mortality rate of 650,000 cases¹. The emergence of highly pathogenic strains creates the risk of pandemics capable of claiming millions of lives, as confirmed by historical examples of Spanish, Asian and Hong Kong flu [2]. Existing vaccines cannot completely prevent the spread of influenza among the population, as they confer immunity to antigenic variants circulating in the human population and are ineffective against newly emerging strains. Further limitations to the effectiveness of mass vaccination include low confidence in vaccines among part of the population, the existence of anti-vaccination movements and propaganda, and the presence of contraindications in a number of patients [3]. Furthermore, the significant relevance of the current threat of an influenza pandemic is due to the recent global outbreak of A/H5N1 2. 3.4.4b among wild and domestic birds, as well as the fact that these viruses are capable of overcoming interspecies barriers, infecting mammals, including minks, pigs, cattle, and humans [4]. The use of classic anti-influenza drugs (Xofluza (baloxavir marboxil), Rapivab (peramivir), Relenza (zanamivir) and Tamiflu (oseltamivir), despite their clear therapeutic effect, also have limited use due to the rapid development of resistance in circulating influenza virus strains, as well as the risk of side effects and allergic reactions in patients [5].

Consequently, the current epidemic situation creates an urgent need to develop a fundamentally new anti-influenza drug, the application of which will not be limited by emergent strains of the influenza virus. Furthermore, such drugs should have the ability to exert a prophylactic and therapeutic effect against other SARS pathogens. Drugs based on the mechanism of RNA interference (RNAi) could be a complete solution to this problem.

RNAi is a biological process that occurs in eukaryotic cells, in which specific gene expression is suppressed at the post-transcriptional level by degradation of the target mRNA sequence. Key participants in the RNAi process are small interfering RNAs (siRNAs) — short double-stranded sequences 19–25 bp in length, derived from foreign exogenous mRNA and acting as targets for the RISC (RNA-induced silencing complex), which binds to the specified siRNA site of mRNA and subjects it to fragmentation [6]. Based on the phenomenon of RNAi, therapeutic antiviral drugs are undergoing laboratory and clinical trials: SNS812 (SARS-CoV-2), Xalnesiran (hepatitis B), Elebsiran (hepatitis B), TKM-Ebola (Ebola fever) [7–10]. Furthermore, the effective antiviral effect of siRNA has now been demonstrated against various animal infections, such as equine viral arteritis, Oropouche fever, bluetongue disease, Schmallenberg disease and Newcastle disease [11–13]. The design and development of new siRNAs for the treatment of viral diseases based on available data and results is a significant step towards achieving the goal of limiting the circulation of viral pathogens among the population [14].

Suppressing viral activity through siRNA-mediated inhibition of cellular genes necessary for viral reproduction is a promising direction, and the potential of this approach is discussed in detail in a study by M. Lesch et al. [15]. The results of our previous studies also demonstrate the potential of antiviral siRNA-mediated inhibition of cellular genes, contributing to the rationale for the effectiveness of this approach [16–18]. Thus, it was previously shown that inhibition of the expression of the cellular genes NXF1, PRPS1 and NAA10 leads to a decrease in the reproduction of the influenza virus strains A/California/7/09 (H1N1)pdm09, A/WSN/33 (H1N1), and A/Brisbane/59/07 (H1N1) strains in an in vitro model [19]. The available in vitro results provide a basis for further research, but their translation into clinical practice requires evaluation of efficacy in more complex biological systems. In order to confirm the antiviral potential of this approach and move on to the preclinical stage, it is critically important to study the safety and efficacy of siRNA-mediated inhibition of the NXF1, PRPS1 and NAA10 genes in whole organisms, which will be the aim of this study.

Materials and methods

siRNA

Nucleotide sequence analysis for the subsequent selection of siRNAs specific to Balb/c mouse genes (Mus musculus species) was performed using Geneious and siDirect 2.1 (University of Tokyo) software. The Geneious software was used to align the mRNA transcripts of the target genes, and then the siDirect 2.1 program was used to select the siRNAs. The synthesis of siRNA was performed at the Syntol Scientific and Production Association. Table 1 provides references to the numbers of target mRNA transcripts in the Blast database (NCBI).

 

Table 1. Target mRNA transcript numbers in the Blast database

siRNA	Target gene (species)	Transcript number	siRNA sequence (5' → 3')
NXF1-1m	NXF1 (Mus musculus)	XM_021151548.2	AGAGAUUUAGGGUCUUUAGdGdT
PRPS1-m	PRPS1 (Mus musculus)	NM_021463.4	AUGUUAUAAAGGAACAUGGdCdT
NAA10-1m	NAA10 (Mus musculus)	XM_036162039.1	AUUGAAGUUCUCUAUCAUGdGdC
siL2 (control non-specific siRNA)	L2 (Lampyris noctiluca)	_	_

 

Virus

Influenza A virus strain: A/California/7/09 (H1N1)pdm09 obtained from the virus collection of the I. Mechnikov Research Institute of Vaccines and Sera.

Cell lines

MDCK dog kidney cell lines (Institut Pasteur) and L929 mouse fibroblasts (I.I. Mechnikov Research Institute of Vaccines and Sera) were used to conduct the study. MDCK and L929 cells were grown in DMEM medium (PanEco) containing 5% fetal bovine serum (Gibco, ThemoFisher Scientific), 40 μg/mL gentamicin (PanEco), and 300 μg/mL L-glutamine (PanEco) at 37°C in a CO₂ incubator (Sanyo).

Laboratory animals

The study used female BALB/c mice (Stolbovaya breeding facility) weighing 16–18 g and aged 7–9 weeks. All experimental procedures were performed in accordance with the Consensus Author Guidelines for Animal Use (IAVES, July 23, 2010). The research protocol was approved by the Ethics Committee of the I.M. Sechenov First Moscow State Medical University (Sechenov University) (protocol No. 04-21 dated February 18, 2021).

Transfection of siRNA into cell culture

Transfection of siRNA was performed in the A549 cell line upon reaching 70% cell monolayer. Geneject40 (Molekta) and Opti-MEM (Thermo Fisher Scientific) reagents were mixed, then siRNA and Opti-MEM were added to the mixture. The resulting complex was incubated for 15 min at 25°C. During incubation, the cells were washed with Hanks' solution (PanEco) and Opti-MEM serum-free medium. The amount of siRNA was 0.00025 mg per well according to the manufacturer's protocol.

MTT test

The cytotoxicity of the obtained siRNA complexes was evaluated using the methyl tetrazolium test (MTT test) on A549 cell culture according to the method described in the paper [20].

Administration of siRNA complexes to mice followed by infection with influenza virus A/California/7/09 H1N1

Mice were infected at 7–9 weeks of age. The recommended amount of siRNA was 1.5 nanomoles/μL [21]. siRNA was administered intranasally to mice under anesthesia, at a dose of 30 μl per animal. The siRNA was administered without a carrier. Four hours after intranasal administration of the siRNA, the mice were infected with the influenza A/California/7/09 H1N1 virus at an LD₅₀ dose. The volume of virus-containing fluid administered was 30 μL for each animal, except for those included in the negative control.

Obtaining mice lungs

On the third day after infection, the mice were euthanized using a gas chamber. After euthanasia, the lungs were removed from the dead animals for subsequent determination of the virus titer by cytopathic effect (CPE) and the amount of viral RNA by real-time reverse transcription polymerase chain reaction (RT-qPCR). The removed lungs were homogenized in 1.5 mL of MEM medium (PanEco) and then centrifuged at 10,000 rpm for 5 minutes in a microcentrifuge (Eppendorf). The supernatant was used for RNA extraction and virus titration in cell culture (samples were pre-filtered using filters with a pore diameter of 0.1 μm). The samples were stored at –70°C for subsequent use in CPE titration and RT-qPCR.

Virus titration by CPE

The virus titer was determined using the CPE titration method at the point of maximum visual cytopathic effect in A549 cell culture. The virus titer was calculated using the Ramakrishnan method [22].

Total RNA detection

Total RNA was extracted from cell lysate and lung homogenate using the ExtractRNA kit (Eurogen) in accordance with the manufacturer's protocol [23]. RNA concentration was determined using a NanoDrop One spectrophotometer (Thermo Fisher). The isolated RNA was stored at –70°C.

RT-qPCR reaction

Reverse transcription was performed using 1 μg of RNA and the OT-1 kit (Sintol) with random hexamer primers. Changes in viral RNA concentration were monitored using RT-qPCR with a set of primers specific for the M gene of influenza A virus. A set of reagents and EVA Green dye (Syntol) were used for PCR. The working concentration of primers was 10 pmol/μL. qPCR was performed in a Roche amplifier: 95°C — 5 min (1 cycle); 61°C — 40 s, 95°C — 15 s (40 cycles). Table 2 shows the sequences of primers used in PCR.

 

Table 2. Primer sequences specific to the NXF1, PRPS1 and NAA10 genes

Gene	Forward-pr. (5' → 3')	Reverse-pr. (3' → 5')
NXF1	TGAGCAGCAACAGGCTATAC	TCCCGCTCAGTCTTCAATTC
PRPS1	CTCCTACTTGTTCAGCCATGTT	TCTTCTGCTCAACTCACCAATAC
NAA10	CTCTCGAGCCATGATAGAGAAC	AGTTGAGGGTGTTGGAATAGAG
Gapdh	CATCACTGCCACCCAGAAGACTG	ATGCCAGTGAGCTTCCCGTTCAG

 

Assessment of changes in gene expression

The relative expression level of each target gene relative to the control (non-specific siRNA siL2) was calculated using the Pfaffl method [24] with normalization to the expression level of the Gapdh gene.

Statistical data processing

The reliability of the final results was assessed using the Wilcoxon rank sum nonparametric statistical test and Microsoft Excel 2013 software (Microsoft) [25]. The difference was considered reliable at a statistical significance level of p ≤ 0.05.

Results

Study of the toxic effect of siRNA

To assess the toxicity of siRNAs targeting the NXF1, PRPS1 and NAA10 genes, they were transfected into L929 cell culture. Further assessment of siRNA toxicity was performed using the MTT assay. Twenty-four hours after transfection, L929 cells retained viability exceeding the toxic level (65–70%), similar to the data reported by M. Estrin et al. [26]. The viability of cells treated with NXF1-m siRNA was 75, 71, and 78% within 3 days after transfection compared to nonspecific siL2 (p ≤ 0.05) and negative controls. When using PRPS1-m, cell viability within 3 days was 81, 82 and 87%, respectively. When transfecting siRNA NAA10-1m, cell viability was estimated at 77, 83 and 89% within 3 days. It can be seen that 72 hours after transfection, the viability of all cells treated with siRNA complexes was restored (Table 3).

 

Table 3. Survival dynamics of L929 cells after siRNA transfection, %

siRNA	Day 1	Day 2	Day 3
NXF1-1m	75 ± 5	71 ± 2	78 ± 4
PRPS1-m	81 ± 4	82 ± 5	87 ± 1
NAA10-1m	77 ± 4	83 ± 3	89 ± 4
siL2	100 ± 5	100 ± 1	100 ± 2

 

The selected siRNA complexes do not exhibit pronounced cytotoxicity toward the transfected A549 cell line, which is one of the criteria for their use in living systems.

Study of the inhibitory effect of siRNA on target cell genes in an in vivo model

For primary screening of siRNA specificity, they were also transfected into L929 cell culture. When using the NXF1-m complex, the expression of the gene of the same name decreased within 3 days from the moment of transfection by 82, 78 and 73% relative to the non-specific control siL2 (p ≤ 0.05). When PRPS1-m siRNA was transfected, the decrease in expression over 3 days was 81, 82 and 87%. The use of the NAA10-m complex led to a decrease in the expression of the gene of the same name by 77, 83 and 89% on Days 1, 2 and 3 (Table 4).

 

Table 4. Expression of NXF1, PRPS1 and NAA10 genes relative to control after siRNA transfection, %

siRNA	Day 1	Day 2	Day 3
NXF1-1m	18 ± 4	22 ± 7	27 ± 3
PRPS1-m	7 ± 6	12 ± 3	19 ± 5
NAA10-1m	6 ± 1	18 ± 7	23 ± 9
siL2	100 ± 5	100 ± 1	100 ± 2

 

Evaluation of the antiviral effect of siRNA against influenza virus in vivo

It has been established that intranasal administration of siRNA causes an antiviral effect against influenza A/California/7/09 (H1N1)pdm09 virus at LD₅₀ in an in vivo model. Mice were necropsied on day 3 after infection, after which the lungs were removed, homogenized and titrated. At LD₅₀, the use of all siRNAs led to a decrease in viral reproduction. The use of NXF1-1m siRNA caused a decrease in viral reproduction on day 3 by 2.7 log10 TCID₅₀/ml relative to nonspecific and viral controls. The viral titer was significantly reduced by 3.1 log10 TCID₅₀/mL compared to the control groups when using PRPS1-1m siRNA. The reduction in viral titer upon administration of NAA10-1m siRNA was 2.1 log10 TCID₅₀/mL (Fig. 1).

 

Fig. 1. Effect of siRNA-mediated suppression of NXF1, PRPS1 and NAA10 genes on the reproduction of influenza A/California/7/09 (H1N1) virus on day 3 after transfection at LD₅₀ (n = 3).

*p < 0.05 relative to nonspecific siL2.

 

The influence of siRNA complexes on the dynamics of influenza A/California/7/09 (H1N1)pdm09 viral RNA

When assessing the effect of siRNA on changes in viral RNA levels using the A/California/7/09 (H1N1) strain, it was found that treatment of cells with NXF1-1m, PRPS1-1m and NAA10-1m siRNA led to a significantly effective reduction in viral RNA on day 3 after cell infection compared to nonspecific and viral controls by 3.2, 2.7, and 2.6 log10 and 2.9 times, respectively (Fig. 2).

 

Fig. 2. Effect of siRNA-mediated suppression of NXF1, PRPS1 and NAA10 genes on the amount of influenza A/California/7/09 (H₁N₁) virus RNA on day 3 after transfection at LD₅₀ (n = 3).

*p < 0.05 relative to nonspecific siL2.

 

Discussion

The RNA interference mechanism is increasingly proving itself to be a powerful tool in suppressing viral reproduction. Previously, it was traditionally believed that viral genes served as targets for siRNAs; however, given the high variability of the influenza A virus and its drug resistance, it is more logical to shift the focus to the use of host cellular factors necessary for viral reproduction as targets [27]. This approach will have a number of advantages:

• multidirectionality against a wide range of taxonomic groups of viruses whose reproduction mechanism may be similar;
• rapid design of similar compounds against emergent viruses;
• synergy with other antiviral agents [15].

The results of this study confirm and expand on our previous findings [28, 29]. This is mediated by the fact that not only is the antiviral efficacy of siRNA application demonstrated in an in vivo model, but also that the most pronounced antiviral effect is observed when the NXF1 gene is inhibited. This effect, manifested in a significant reduction in viral titer and viral RNA content, is explained by the critical role of the NXF1 protein in the transport of viral mRNAs from the nucleus—a stage that is difficult to replace for viruses that carry out part of the replication process in the nucleus [30].

In the present study, much like in a previous in vitro study [19], the most pronounced antiviral effect was associated with silencing of the NXF1 gene. The PRPS1 and NAA10 genes were also selected as targets in the screening approach based on their potential role in viral reproduction: PRPS1 is involved in purine synthesis, and NAA10 is involved in post-translational protein acetylation. However, their suppression likely affects more general cellular metabolic pathways, which can be partially compensated for by the cell and for which the influenza virus may also find alternatives during its reproduction, explaining the less pronounced effect compared to targeting NXF1. The key role of the NXF1 protein as the main mediator of nuclear mRNA import/export creates a bottleneck in the life cycle of the influenza A virus, making this target particularly effective.

The in vivo data we obtained are particularly significant in light of the growing body of evidence supporting the universal role of NXF1 in the life cycles of various viruses, from coronaviruses (SARS-CoV-2) and filoviruses (Ebola) to retroviruses (HIV-1) [31–33]. The NXF1 protein is an integral component of the nuclear pore complex (NPC), a vital regulator of molecular transport between the nucleus and cytoplasm in eukaryotic cells [34]. In recent years, there has been growing evidence that functional insufficiency of NPC components or associated transport factors is not a consequence but a direct link in the pathogenesis of a wide range of diseases, including those of non-infectious etiology [35, 36]. Thus, changes in the biological processes associated with the activity of the transport endosomal sorting complex, whose main tasks are to participate in the processes of nuclear envelope repair and quality control of molecules passing through the NPC, can lead to the development of various neurodegenerative diseases, including amyotrophic lateral sclerosis and frontotemporal dementia [37]. The pathogenesis of some oncological diseases (mainly hematological) may also be due to a disruption in the functioning of the NPC or its transport components. Thus, dysfunction of the Nup98 nucleoporin protein may be associated with hematological neoplasms such as myelodysplastic syndrome, acute myeloid leukemia, and chronic myeloid leukemia; and mutations in the NXF1 gene are often associated with the development of chronic lymphocytic leukemia [38, 39].

Many viruses are also capable of manipulating structural components and processes in the NPC to complete their life cycle. For example, some gamma retroviruses, such as mouse leukemia virus and xenotropic mouse leukemia virus, are capable of using the NXF1 protein to export viral RNA [40]. The export of influenza virus RNA synthesized in the nucleus also depends on NXF1, where the viral NS1 protein acts as a link/adapter between viral RNA and NXF1 [41]. Similar interactions with NXF1 are observed for Ebola virus, herpes simplex virus, and herpesvirus saimiri, which use NP, ICP27 and TIP proteins, respectively, to bind to NXF1 [42]. In summary, nucleoporin dysfunction and mutations, as well as impaired transport through the NPC, are often associated with oncogenesis, the development of neurological diseases, and the genesis of viral infections. Accordingly, the structures and components of the NPC serve as a common pathogenetic hub for diseases of an infectious and somatic nature.

The results obtained in this study demonstrate that knockdown of the NXF1 gene under acute experimental conditions was not accompanied by visible signs of toxicity and resulted in a significant anti-influenza effect. Inhibition of NXF1 expression, which does not induce negative consequences for the cell in the presence of an acute infectious process, indicates the promise of a strategy of silencing cellular genes whose expression products play an important role in the process of viral reproduction [15]. Furthermore, disrupting the activity of one component of the RNA processing complex, rather than suppressing the functioning of the entire complex, appears to be less harmful to the cell and a more rapidly implementable approach in antiviral therapy and emergency prophylaxis. This principle opens up a wide range of possibilities for the design of new approaches aimed not only at viral infections, but also at other diseases in which the activity of the NPC plays a key role. It should be noted that a full assessment of the pharmacokinetics, long-term safety, and reversibility of the effect requires additional specialized studies.

In addition to the above, apart from the strategy of inhibiting proviral cellular factors, an alternative approach could be the development of therapeutic approaches aimed at enhancing the expression of innate immune genes (e.g., type I interferons and interferon-stimulated genes) or genes whose expression products are involved in the barrier function of the respiratory epithelium. The combination of these two strategies—inhibiting viral reproduction and simultaneously enhancing the body's defenses—may be the most effective approach to combating severe forms of ARVI.

Conclusion

These data further confirm that genes encoding the expression of proteins forming the NPC are potentially effective targets for the design and development of antiviral siRNAs. Reduced expression of NPC components correlates with decreased reproductive activity of influenza viruses, and the creation of antiviral drugs based on RNAi represents a promising vector for the development of anti-influenza drugs based on the RNAi mechanism. Along with this, the results obtained contribute to the development of principles for the rapid design and creation of specific antimicrobial agents intended to protect against both existing and potentially dangerous new emergent pathogens; ensuring and implementing anti-epidemic protection of the population; rapid and effective response in the event of pandemics, biogenic threats, as well as cases of bioterrorism [43, 44].

 

¹ WHO. Up to 650 000 people die of respiratory diseases linked to seasonal flu each year. URL: https://www.who.int/ru/news/item/14-12-2017-up-to-650-000-people-die-of-respiratory-diseases-linked-to-seasonal-flu-each-year

About the authors

Evgenij A. Pashkov

I. Mechnikov Research Institute of Vaccines and Sera; Sechenov First Moscow State Medical University (Sechenov University)

Author for correspondence.
Email: pashckov.j@yandex.ru
ORCID iD: 0000-0002-5682-4581

Cand. Sci. (Med.), junior researcher, Laboratory of applied virology, Department of virology named after O.G. Andzhaparidze, I. Mechnikov Research Institute of Vaccines and Sera; senior lecturer, Microbiology, virology and immunology department named after acad. A.A. Vorobiev, Faculty of Preventive Medicine, F.F. Erisman Institute of Public Health, Sechenov University

Russian Federation, Moscow; Moscow

George A. Pashkov

I. Mechnikov Research Institute of Vaccines and Sera; Sechenov First Moscow State Medical University (Sechenov University)

Email: georgp2004@mail.ru
ORCID iD: 0000-0003-0392-9969

laboratory assistant-researcher, Laboratory of opportunistic microorganisms, Microbiology department, I. Mechnikov Research Institute of Vaccines and Sera; student, Clinical institute of children health, Sechenov University

Russian Federation, Moscow; Moscow

Firaya G. Nagieva

I. Mechnikov Research Institute of Vaccines and Sera

Email: fgn42@yandex.ru
ORCID iD: 0000-0001-8204-4899

Dr. Sci. (Med.), Associate Professor, Head, Laboratory of hybrid cell cultures, Department of virology named after O.G. Andzhaparidze

Russian Federation, Moscow

Alena A. Murzina

I. Mechnikov Research Institute of Vaccines and Sera

Email: alena_11_08@mail.ru
ORCID iD: 0000-0001-9029-9613

Cand. Sci. (Med.), senior researcher, Laboratory for epidemiological analysis and monitoring of infectious diseases, Microbiology department

Russian Federation, Moscow

Irina B. Semenova

I. Mechnikov Research Institute of Vaccines and Sera

Email: ibsemenova@yandex.ru
ORCID iD: 0000-0002-6630-4838

Dr. Sci. (Med.), leading researcher, Laboratory of therapeutic vaccines, Immunology and allergology department

Russian Federation, Moscow

Galina N. Usatova

Sechenov First Moscow State Medical University (Sechenov University)

Email: g.n.usatova@mail.ru
ORCID iD: 0000-0002-8955-3570

Cand. Sci. (Med.), Associate Professor, Microbiology, virology and immunology department named after acad. A.A. Vorobiev, F.F. Erisman Institute of Public Health

Russian Federation, Moscow

Oxana A. Svitich

I. Mechnikov Research Institute of Vaccines and Sera; Sechenov First Moscow State Medical University (Sechenov University)

Email: svitichoa@yandex.ru
ORCID iD: 0000-0003-1757-8389

Dr. Sci. (Med.), Professor, Full member of RAS, Director, Head, Laboratory of molecular immunology, Immunology and Allergology department, I. Mechnikov Research Institute of Vaccines and Sera; Professor, Microbiology, virology and immunology department named after acad. A.A. Vorobiev, Faculty of Preventive Medicine, F.F. Erisman Institute of Public Health, Sechenov University

Russian Federation, Moscow; Moscow

Vitaliy V. Zverev

I. Mechnikov Research Institute of Vaccines and Sera; Sechenov First Moscow State Medical University (Sechenov University)

Email: vitalyzverev@outlook.com
ORCID iD: 0000-0002-0017-1892

Dr. Sci. (Biol.), Professor, Full member of RAS, Scientific Adviser, I. Mechnikov Research Institute of Vaccines and Sera; Professor, Head, Microbiology, virology and immunology department named after acad. A.A. Vorobiev, F.F. Erisman Institute of Public Health, Sechenov University

Russian Federation, Moscow; Moscow

References

Supplementary files